SubtiBank SubtiBank
artR
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

artR

high affinity arginine [SW|ABC transporter ](ATP-binding protein)
locus
BSU_23960
pI
9.13
mw
26.80 kDa
protein length
240 aa Sequence Blast
gene length
723 bp Sequence Blast
function
arginine uptake
product
high affinity arginine [SW|ABC transporter ](ATP-binding protein)
essential
no
synonyms
artM,yqiZ

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.1|Importers] → [category|SW 1.2.1.1.2|Uptake of amino acids]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.4|Biosynthesis/ acquisition of arginine]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,490,574 2,491,296

    The protein

    Protein family

  • [SW|ABC transporter superfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|B24763A732111026D21C828FF9BE73FB22A123CF|TcyN], [protein|B453986691E1231A1C565D469A2A60EBFF2F6BD3|TcyC], [protein|F8C800CF71D21A1F3265977C4F0EE191D0FFE36A|YxeO], [protein|0D5BC94E21D51373A50D61CE3D0895B3DB28F6B3|PstBB], [protein|0F8048267EC038D8CF673317D969BA27735473A7|YvrO], [protein|468BEA9EAEA589D683DB79B2C689A5C6A22AB67F|GlnQ], [protein|434BCED6953BE07D592AC229264C5AD0D04CBAF6|PstBA]
  • [SW|Domains]

  • [SW|ABC transporter domain] (aa 2-236) (according to UniProt)
  • Structure

  • [PDB|4YMS] (from Caldanaerobacter subterraneus, 44% identity) [pubmed|25848002]
  • [SW|Localization]

  • cell membrane (via [protein|62BD291B91DB0358754957D84A1F3636C247A697|ArtQ])
  • Expression and Regulation

    Operons

    genes
    [gene|8D9529D46E11D8B2826A98642706ADCBE1E3434A|artP]-[gene|62BD291B91DB0358754957D84A1F3636C247A697|artQ]-[gene|6882EF93EC82872B25C88104F62D6603D2514890|artR]
    description
    [Pubmed|12107147]

    regulatory mechanism

  • [protein|F4097349A563503468A2A14F062AEAC532C7917A|YlxR]: regulation, [pubmed|30355672], in [regulon|F4097349A563503468A2A14F062AEAC532C7917A|YlxR regulon]
  • regulation

  • repressed by casamino acids [Pubmed|12107147]
  • induced in the absence of [protein|F4097349A563503468A2A14F062AEAC532C7917A|YlxR] [pubmed|30355672]
  • view in new tab

    Biological materials

    Mutant

  • GP1689 Δ([gene|8D9529D46E11D8B2826A98642706ADCBE1E3434A|artP]-[gene|62BD291B91DB0358754957D84A1F3636C247A697|artQ]-[gene|6882EF93EC82872B25C88104F62D6603D2514890|artR])::''mls'', available in [SW|Jörg Stülke]'s lab
  • MGNA-C383 ([gene|6882EF93EC82872B25C88104F62D6603D2514890|artR]::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2381 NBRP B. subtilis, Japan]
  • BKE23960 ([gene|6882EF93EC82872B25C88104F62D6603D2514890|artR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE23960 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AAATGATTTTGACAGCTTTT, downstream forward: _UP4_TAGAATATAAAAAAGAAGAA
  • BKK23960 ([gene|6882EF93EC82872B25C88104F62D6603D2514890|artR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK23960 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AAATGATTTTGACAGCTTTT, downstream forward: _UP4_TAGAATATAAAAAAGAAGAA
  • References

  • 10092453,11423008,12107147,25848002