SubtiBank SubtiBank


high affinity arginine [SW|ABC transporter ](ATP-binding protein)
26.80 kDa
protein length
240 aa Sequence Blast
gene length
723 bp Sequence Blast
arginine uptake
high affinity arginine [SW|ABC transporter ](ATP-binding protein)

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW|Importers] → [category|SW|Uptake of amino acids]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of arginine]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    2,490,574 2,491,296

    The protein

    Protein family

  • [SW|ABC transporter superfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|B24763A732111026D21C828FF9BE73FB22A123CF|TcyN], [protein|B453986691E1231A1C565D469A2A60EBFF2F6BD3|TcyC], [protein|F8C800CF71D21A1F3265977C4F0EE191D0FFE36A|YxeO], [protein|0D5BC94E21D51373A50D61CE3D0895B3DB28F6B3|PstBB], [protein|0F8048267EC038D8CF673317D969BA27735473A7|YvrO], [protein|468BEA9EAEA589D683DB79B2C689A5C6A22AB67F|GlnQ], [protein|434BCED6953BE07D592AC229264C5AD0D04CBAF6|PstBA]
  • [SW|Domains]

  • [SW|ABC transporter domain] (aa 2-236) (according to UniProt)
  • Structure

  • [PDB|4YMS] (from Caldanaerobacter subterraneus, 44% identity) [pubmed|25848002]
  • [SW|Localization]

  • cell membrane (via [protein|62BD291B91DB0358754957D84A1F3636C247A697|ArtQ])
  • Expression and Regulation



    regulatory mechanism

  • [protein|F4097349A563503468A2A14F062AEAC532C7917A|YlxR]: regulation, [pubmed|30355672], in [regulon|F4097349A563503468A2A14F062AEAC532C7917A|YlxR regulon]
  • regulation

  • repressed by casamino acids [Pubmed|12107147]
  • induced in the absence of [protein|F4097349A563503468A2A14F062AEAC532C7917A|YlxR] [pubmed|30355672]
  • view in new tab

    Biological materials


  • GP1689 Δ([gene|8D9529D46E11D8B2826A98642706ADCBE1E3434A|artP]-[gene|62BD291B91DB0358754957D84A1F3636C247A697|artQ]-[gene|6882EF93EC82872B25C88104F62D6603D2514890|artR])::''mls'', available in [SW|Jörg Stülke]'s lab
  • MGNA-C383 ([gene|6882EF93EC82872B25C88104F62D6603D2514890|artR]::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE23960 ([gene|6882EF93EC82872B25C88104F62D6603D2514890|artR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AAATGATTTTGACAGCTTTT, downstream forward: _UP4_TAGAATATAAAAAAGAAGAA
  • BKK23960 ([gene|6882EF93EC82872B25C88104F62D6603D2514890|artR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AAATGATTTTGACAGCTTTT, downstream forward: _UP4_TAGAATATAAAAAAGAAGAA
  • References

  • 10092453,11423008,12107147,25848002