SubtiBank SubtiBank
ywjB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ywjB

unknown
locus
BSU_37220
pI
4.53
mw
19.44 kDa
protein length
174 aa Sequence Blast
gene length
525 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    3,819,220 3,819,744

    The protein

    Structure

  • [PDB|2GD9] ([protein|E2CABD337831904871E0F0260DAA992E41A4F9E0|YyaP], 31% identity)
  • [SW|Localization]

  • membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|07752EC6940F43DEBD1E9313A2A195E35EDB9F69|ywiE]-[gene|D5A3C316BD4567A0155F70330E32ACDE18F063FE|ywjA]-[gene|685B58AD2A02A0B48B7D4AAAE046DE2CF8F77C58|ywjB]
    description
    [pubmed|22383849]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|26577401], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulatory mechanism

  • [protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]: repression, [pubmed|12354229], in [regulon|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur regulon]
  • view in new tab

    genes
    [gene|D5A3C316BD4567A0155F70330E32ACDE18F063FE|ywjA]-[gene|685B58AD2A02A0B48B7D4AAAE046DE2CF8F77C58|ywjB]
    description
    [pubmed|22383849]
    view in new tab

    genes
    [gene|685B58AD2A02A0B48B7D4AAAE046DE2CF8F77C58|ywjB]
    description
    [Pubmed|9353933]

    regulatory mechanism

  • [protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]: repression, [pubmed|12354229], in [regulon|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur regulon]
  • regulation

  • repressed unless the cells enter an iron starvation ([protein|search|Fur]) [Pubmed|12354229]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B661 (ywjB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1660 NBRP B. subtilis, Japan]
  • BKE37220 ([gene|685B58AD2A02A0B48B7D4AAAE046DE2CF8F77C58|ywjB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE37220 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTCTCCTCCTATCGAT, downstream forward: _UP4_TAAGAAAAAGGATAGACAGA
  • BKK37220 ([gene|685B58AD2A02A0B48B7D4AAAE046DE2CF8F77C58|ywjB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK37220 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTCTCCTCCTATCGAT, downstream forward: _UP4_TAAGAAAAAGGATAGACAGA
  • References

  • 12354229,9353933