SubtiBank SubtiBank
pucE
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

pucE

xanthine dehydrogenase
locus
BSU32470
pI
6.13
mw
18.69 kDa
protein length
173 aa Sequence Blast
gene length
522 bp Sequence Blast
function
purine utilization
product
xanthine dehydrogenase
essential
no
synonyms
yurB

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.1|Utilization of nucleotides]
  • Gene

    Coordinates
    3,335,751 3,336,272

    The protein

    Catalyzed reaction/ biological activity

  • Xanthine + NAD+ + H2O = urate + NADH (according to Swiss-Prot)
  • [SW|Cofactors]

  • Fe-S cluster [pubmed|29292548]
  • Structure

  • [PDB|1JRO] (from ''Rhodobacter capsulatus'', 43% identity, 58% similarity) [Pubmed|11796116]
  • Expression and Regulation

    Operons

    genes
    [gene|C9370B221117B89A1134B413748D39505C2E1DA8|pucA]-[gene|99428BD0B1A8E91F4B028ACF8AB51B235DDB4F11|pucB]-[gene|D0F00ACF5AAD9E9418033F5B47527C4D50007F18|pucC]-[gene|B65E4B340961332ED0ACC7FD957351256F708F60|pucD]-[gene|6855CC156FCB4C4A16AFD6ADE18F3FFC82B61843|pucE]
    description
    [Pubmed|12823818]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|12029039], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|52C1601482C26400A524E880334BB801F832D6ED|PucR]: activation, [Pubmed|12029039], in [regulon|52C1601482C26400A524E880334BB801F832D6ED|PucR regulon]
  • regulation

  • induced in the presence of purine nucleotides (effector: allantoin) ([protein|search|PucR]) [Pubmed|12029039]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A939 (yurB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/939 NBRP B. subtilis, Japan]
  • BKE32470 ([gene|6855CC156FCB4C4A16AFD6ADE18F3FFC82B61843|pucE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE32470 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TACAGGAAATGGCCCGGCCT, downstream forward: _UP4_TAAAAGCCGGACTTTTTTAG
  • BKK32470 ([gene|6855CC156FCB4C4A16AFD6ADE18F3FFC82B61843|pucE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK32470 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TACAGGAAATGGCCCGGCCT, downstream forward: _UP4_TAAAAGCCGGACTTTTTTAG
  • References

  • 11344136,12029039,12823818