SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


PBSX prophage, similar to R-Type bacteriocin tube protein
16.21 kDa
protein length
147 aa Sequence Blast
gene length
444 bp Sequence Blast

Genomic Context



  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.1|PBSX prophage]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    1,333,804 1,334,247

    The protein

    Paralogous protein(s)

  • [protein|298588F646B7271A91DAEEE60967AA4C134A8082|YqbM]: 95% identity
  • Structure

  • [PDB|2GUJ]
  • [SW|Localization]

  • extracellular (no signal peptide) [Pubmed|18957862]
  • Expression and Regulation



    sigma factors

  • [protein|458406A4E6824C24493CFC19718F10720AA3B453|Xpf]: sigma factor, [Pubmed|8083174], in [regulon|458406A4E6824C24493CFC19718F10720AA3B453|Xpf regulon]
  • regulation

  • expression during spore [SW|germination] is strongly reduced under conditions of osmotic stress [Pubmed|27766092]
  • view in new tab

    Biological materials


  • BKE12660 ([gene|683D350D98AC0D27951145AD87830B89C0B4F393|xkdM]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGTGTTTTGTGCTTTTAATG, downstream forward: _UP4_TAATCAAAGCTGAATCAGCC
  • BKK12660 ([gene|683D350D98AC0D27951145AD87830B89C0B4F393|xkdM]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGTGTTTTGTGCTTTTAATG, downstream forward: _UP4_TAATCAAAGCTGAATCAGCC
  • References

  • 2110147,8083174,18957862,30127773