SubtiBank SubtiBank
dhaS
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

dhaS

3-hydroxypropionaldehyde-specific aldehyde dehydrogenase (NAD)
locus
BSU19310
pI
5.02
mw
53.71 kDa
protein length
495 aa Sequence Blast
gene length
1488 bp Sequence Blast
function
unknown
product
aldehyde dehydrogenase (NAD)
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    2,100,580 2,102,067

    The protein

    Paralogous protein(s)

  • [protein|69838717DC6BB27864D88C282BF5BC7CC558BFD7|RocA], [protein|762718A15E5256261D79DF60F9106AF0CE2D60C6|IolA], [protein|99F1FAF28FB4817D94E84BD5288FA33124558933|YwdH], [protein|A0BEB92D54799956A4ADE106A1388E5710141069|GabD], [protein|EF0AAAF5BAE8E1F54FCA296643F7B9E3CE257B1D|YfmT], [protein|F3341F205CB939498109D2A54DE842065C488DD5|AldX], [protein|F9CF067A2A8E3B2BACC6A51A0E87E84640349980|AldY], [protein|1ADC55F8E265AF86E29743C671CE1EA1BE7EB41E|GbsA], [protein|2042F691CB37B1BAFE2CF3906A9F7F47457C3995|PutC], [protein|5B66ADB81AB141982F187B1C5E3A9346AA064DE2|YcbD]
  • [SW|Cofactors]

  • NAD+ [Pubmed|25409630]
  • Structure

  • [PDB|3RHH] (from ''Bacillus halodurans'' C-125 complexed with NADP, 32% identity, 64% similarity)
  • [PDB|4PS9] (from ''Bacillus cereus'' (62%))
  • Expression and Regulation

    Operons

    genes
    [gene|67A72A0EABCD807C25D8EAC61C251142B45C174E|dhaS]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE19310 ([gene|67A72A0EABCD807C25D8EAC61C251142B45C174E|dhaS]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19310 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCGTAACAAACCTCCAG, downstream forward: _UP4_TAACATGTATGTTTAAAAAA
  • BKK19310 ([gene|67A72A0EABCD807C25D8EAC61C251142B45C174E|dhaS]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19310 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCGTAACAAACCTCCAG, downstream forward: _UP4_TAACATGTATGTTTAAAAAA
  • References

  • 25409630