SubtiBank SubtiBank
dhaS
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

dhaS

3-hydroxypropionaldehyde-specific aldehyde dehydrogenase (NAD)
locus
BSU_19310
pI
5.02
mw
53.71 kDa
protein length
495 aa Sequence Blast
gene length
1488 bp Sequence Blast
function
unknown
product
aldehyde dehydrogenase (NAD)
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    2,100,580 2,102,067

    The protein

    Catalyzed reaction/ biological activity

  • aldehyde + H2O + NAD+ --> carboxylate + 2 H+ + NADH (according to UniProt)
  • Protein family

  • [SW|aldehyde dehydrogenase family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|69838717DC6BB27864D88C282BF5BC7CC558BFD7|RocA], [protein|762718A15E5256261D79DF60F9106AF0CE2D60C6|IolA], [protein|99F1FAF28FB4817D94E84BD5288FA33124558933|YwdH], [protein|A0BEB92D54799956A4ADE106A1388E5710141069|GabD], [protein|EF0AAAF5BAE8E1F54FCA296643F7B9E3CE257B1D|YfmT], [protein|F3341F205CB939498109D2A54DE842065C488DD5|AldX], [protein|F9CF067A2A8E3B2BACC6A51A0E87E84640349980|AldY], [protein|1ADC55F8E265AF86E29743C671CE1EA1BE7EB41E|GbsA], [protein|2042F691CB37B1BAFE2CF3906A9F7F47457C3995|PutC], [protein|5B66ADB81AB141982F187B1C5E3A9346AA064DE2|YcbD]
  • [SW|Cofactors]

  • NAD+ [Pubmed|25409630]
  • Structure

  • [PDB|3RHH] (from ''Bacillus halodurans'' C-125 complexed with NADP, 32% identity, 64% similarity)
  • [PDB|4PS9] (from ''Bacillus cereus'' (62%))
  • Expression and Regulation

    Operons

    genes
    [gene|67A72A0EABCD807C25D8EAC61C251142B45C174E|dhaS]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE19310 ([gene|67A72A0EABCD807C25D8EAC61C251142B45C174E|dhaS]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19310 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCGTAACAAACCTCCAG, downstream forward: _UP4_TAACATGTATGTTTAAAAAA
  • BKK19310 ([gene|67A72A0EABCD807C25D8EAC61C251142B45C174E|dhaS]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19310 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCGTAACAAACCTCCAG, downstream forward: _UP4_TAACATGTATGTTTAAAAAA
  • References

  • 25409630