SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


transcriptional antiterminator for the [gene|AE02C38397AA790E4B216BB6DBABFE907B984D05|sacP]-[gene|8C2DD87E0351BBEE0FD8C0462087CCAD7459AA88|sacA]-[gene|803ED978141A0E09F1F9CAECAB4BA839D480241F|ywdA] operon
31.92 kDa
protein length
276 aa Sequence Blast
gene length
831 bp Sequence Blast
regulation of sucrose utilization
transcriptional antiterminator

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of sucrose]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|PRD-type regulators]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.4|RNA binding regulators]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.9|Phosphoproteins / Other]
  • Gene

    3,906,142 3,906,972

    The protein

    Catalyzed reaction/ biological activity

  • binding to the mRNA of the ''[gene|AE02C38397AA790E4B216BB6DBABFE907B984D05|sacP]-[gene|8C2DD87E0351BBEE0FD8C0462087CCAD7459AA88|sacA]'' operon, causes transcription antitermination (in presence of sucrose and absence of glucose)
  • Protein family

  • [SW|PRD-containing transcription factors]
  • Paralogous protein(s)

  • [protein|BC0DF593AE969F1DBC5E9E2BACF1C00BE4FEE449|GlcT], [protein|EB330AB3DC6C8C3EC72C4CAFA2BC59CC485EE344|SacY], [protein|FAC682CCD66056A8CBB9AE5F4BF51C1AADEBBD2C|LicT]
  • [SW|Domains]

  • N-terminal RNA binding domain [Pubmed|10610766]
  • 2 x [SW|PRD] ([protein|14ED1AF5038F43F3B151FCBABE6CFC5A2DA3AA6E|PtsI] regulation domains) [Pubmed|9663674]
  • 2 [SW|PRD] domains (aa 62-167, aa 168-276) (according to UniProt)
  • Modification

  • Phosphorylated and inactivated by [protein|AE02C38397AA790E4B216BB6DBABFE907B984D05|SacP] (EIIScr) (according to Swiss-Prot)
  • Structure

  • [PDB|1TLV] (the [SW|PRD] domains of [protein|FAC682CCD66056A8CBB9AE5F4BF51C1AADEBBD2C|LicT], corresponds to aa 54 ... 271, 41% identity) [pubmed|15699035]
  • Expression and Regulation



    regulatory mechanism

  • [protein|6740108089F13116F200C15F35C2E7561E990FEB|DnaA]: repression, [Pubmed|26020636], in [regulon|6740108089F13116F200C15F35C2E7561E990FEB|DnaA regulon]
  • regulation

  • repressed by casamino acids [Pubmed|12107147]
  • view in new tab


    regulatory mechanism

  • [protein|6740108089F13116F200C15F35C2E7561E990FEB|DnaA]: repression, [Pubmed|26020636], in [regulon|6740108089F13116F200C15F35C2E7561E990FEB|DnaA regulon]
  • regulation

  • repressed by casamino acids [Pubmed|12107147]
  • additional information

  • the mRNA is substantially stabilized upon depletion of [gene|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
  • view in new tab

    Biological materials


  • GP429 (spc), available in [SW|Jörg Stülke]'s lab
  • BKE38070 ([gene|6796E1C147AA21E919A42A953884DC24E182F430|sacT]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGAGGTTATCTCTCCCGC, downstream forward: _UP4_TAACCGCTTTGACTTGCAGG
  • BKK38070 ([gene|6796E1C147AA21E919A42A953884DC24E182F430|sacT]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGAGGTTATCTCTCCCGC, downstream forward: _UP4_TAACCGCTTTGACTTGCAGG
  • Expression vectors

  • for expression, purification of both PRDs in ''E. coli'' with N-terminal His-tag, in [SW|pWH844]: pGP166, available in [SW|Jörg Stülke]'s lab
  • for expression, purification of PRD-1 in ''E. coli'' with N-terminal His-tag, in [SW|pWH844]: pGP426, available in [SW|Jörg Stülke]'s lab
  • for expression, purification of PRD-2 in ''E. coli'' with N-terminal His-tag, in [SW|pWH844]: pGP427, available in [SW|Jörg Stülke]'s lab
  • for expression, purification of PRD-1 in ''E. coli'' with N-terminal His-tag and thrombin cleavage site, in [SW|pGP570]: pGP439, available in [SW|Jörg Stülke]'s lab
  • for expression, purification of PRD-2 in ''E. coli'' with N-terminal His-tag and thrombin cleavage site, in [SW|pGP570]: pGP440, available in [SW|Jörg Stülke]'s lab
  • for expression, purification of RNA-binding domain in ''E. coli'' with N-terminal His-tag and thrombin cleavage site, in [SW|pGP570]: pGP571, available in [SW|Jörg Stülke]'s lab
  • for expression of RNA-binding domain in ''B. subtilis'', in [SW|pBQ200]: pGP446, available in [SW|Jörg Stülke]'s lab
  • for expression, purification of [gene|6796E1C147AA21E919A42A953884DC24E182F430|sacT]-full length in ''B. subtilis'' with C-terminal Strep-tag, in [SW|pGP382]: pGP1064, available in [SW|Jörg Stülke]'s lab
  • for expression, purification of [gene|6796E1C147AA21E919A42A953884DC24E182F430|sacT]-full length in ''B. subtilis'' with N-terminal Strep-tag, in [SW|pGP380]: pGP1068, available in [SW|Jörg Stülke]'s lab
  • GFP fusion

  • GP1227 (spc, based on [SW|pGP1870]), available in [SW|Jörg Stülke]'s lab
  • FLAG-tag construct

  • GP1223 (spc, based on [SW|pGP1331]), available in [SW|Jörg Stülke]'s lab
  • References


  • 9663674,18086213
  • Original publications

  • 12107147,2163394,1577686,8702561,1279678,21278164,26020636,22383849,15699035