SubtiBank SubtiBank
sacT
An ordered knock out library of all non-essential genes in B. subtilis is now available at Addgene. Information on ordering a copy can be found here. See Koo et al. 2017 for details about library construction.

sacT

transcriptional antiterminator for the sacP-sacA-ywdA operon
locus
BSU38070
pI
5.59
mw
31.92 kDa
protein length
276 aa Sequence Blast
gene length
828 bp Sequence Blast
function
regulation of sucrose utilization
product
transcriptional antiterminator
essential
no
synonyms
ipa-47d

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.19|Utilization of sucrose]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.3|PRD-type regulators]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.4|RNA binding regulators]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.9|Phosphoproteins / Other]
  • Gene

    Coordinates
    3,906,142 → 3,906,972

    The protein

    Catalyzed reaction/ biological activity

  • binding to the mRNA of the ''[gene|AE02C38397AA790E4B216BB6DBABFE907B984D05|sacP]-[gene|8C2DD87E0351BBEE0FD8C0462087CCAD7459AA88|sacA]'' operon, causes transcription antitermination (in presence of sucrose and absence of glucose)
  • Protein family

  • [SW|PRD-containing transcription factors|transcriptional antiterminator] bglG family (according to Swiss-Prot) BglG family of antiterminators
  • Paralogous protein(s)

  • [protein|FAC682CCD66056A8CBB9AE5F4BF51C1AADEBBD2C|LicT], [protein|EB330AB3DC6C8C3EC72C4CAFA2BC59CC485EE344|SacY], [protein|BC0DF593AE969F1DBC5E9E2BACF1C00BE4FEE449|GlcT]
  • [SW|Domains]

  • N-terminal RNA binding domain [Pubmed|10610766]
  • 2 x [SW|PRD] ([protein|14ED1AF5038F43F3B151FCBABE6CFC5A2DA3AA6E|PtsI] regulation domains) [Pubmed|9663674]
  • Modification

  • Phosphorylated and inactivated by SacP (EII-Scr). (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|6796E1C147AA21E919A42A953884DC24E182F430|sacT]
    description
    [Pubmed|9353933]

    regulatory mechanism

  • [protein|6740108089F13116F200C15F35C2E7561E990FEB|DnaA]: repression, [Pubmed|26020636], in [regulon|6740108089F13116F200C15F35C2E7561E990FEB|DnaA regulon]
  • regulation

  • repressed by casamino acids [Pubmed|12107147]
  • view in new tab

    genes
    [gene|2D58D48D81ADD705B519D202568939B980AF86DB|ywcI]-[gene|6796E1C147AA21E919A42A953884DC24E182F430|sacT]
    description
    [Pubmed|22383849]

    regulatory mechanism

  • [protein|6740108089F13116F200C15F35C2E7561E990FEB|DnaA]: repression, [Pubmed|26020636], in [regulon|6740108089F13116F200C15F35C2E7561E990FEB|DnaA regulon]
  • regulation

  • repressed by casamino acids [Pubmed|12107147]
  • additional information

  • the mRNA is substantially stabilized upon depletion of [Rny|search|RNase Y] [PubMed|21815947]
  • view in new tab

    Biological materials

    Mutant

  • GP429 (spc), available in [SW|Jörg Stülke]'s lab
  • BKE38070 (Δ[gene|6796E1C147AA21E919A42A953884DC24E182F430|sacT]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE38070 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGAGGTTATCTCTCCCGC, downstream forward: _UP4_TAACCGCTTTGACTTGCAGG
  • BKK38070 (Δ[gene|6796E1C147AA21E919A42A953884DC24E182F430|sacT]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK38070 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGAGGTTATCTCTCCCGC, downstream forward: _UP4_TAACCGCTTTGACTTGCAGG
  • Expression vector

  • for expression, purification of both PRDs in ''E. coli'' with N-terminal His-tag, in [SW|pWH844]: pGP166, available in [SW|Jörg Stülke]'s lab
  • for expression, purification of PRD-1 in ''E. coli'' with N-terminal His-tag, in [SW|pWH844]: pGP426, available in [SW|Jörg Stülke]'s lab
  • for expression, purification of PRD-2 in ''E. coli'' with N-terminal His-tag, in [SW|pWH844]: pGP427, available in [SW|Jörg Stülke]'s lab
  • for expression, purification of PRD-1 in ''E. coli'' with N-terminal His-tag and thrombin cleavage site, in [SW|pGP570]: pGP439, available in [SW|Jörg Stülke]'s lab
  • for expression, purification of PRD-2 in ''E. coli'' with N-terminal His-tag and thrombin cleavage site, in [SW|pGP570]: pGP440, available in [SW|Jörg Stülke]'s lab
  • for expression, purification of the RNA-binding domain in ''E. coli'' with N-terminal His-tag and thrombin cleavage site, in [SW|pGP570]: pGP571, available in [SW|Jörg Stülke]'s lab
  • for expression of the RNA-binding domain in ''B. subtilis'', in [SW|pBQ200]: pGP446, available in [SW|Jörg Stülke]'s lab
  • for expression, purification of [gene|6796E1C147AA21E919A42A953884DC24E182F430|sacT]-full length in ''B. subtilis'' with C-terminal Strep-tag, in [SW|pGP382]: pGP1064, available in [SW|Jörg Stülke]'s lab
  • for expression, purification of [gene|6796E1C147AA21E919A42A953884DC24E182F430|sacT]-full length in ''B. subtilis'' with N-terminal Strep-tag, in [SW|pGP380]: pGP1068, available in [SW|Jörg Stülke]'s lab
  • GFP fusion

  • GP1227 (spc, based on [SW|pGP1870]), available in [SW|Jörg Stülke]'s lab
  • FLAG-tag construct

  • GP1223 (spc, based on [SW|pGP1331]), available in [SW|Jörg Stülke]'s lab
  • References

    Reviews

  • 9663674,18086213
  • Original publications

  • 12107147,2163394,1577686,8702561,1279678,21278164,26020636,22383849