SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


aliphatic sulfonate [SW|ABC transporter] (binding protein)
30.08 kDa
protein length
255 aa Sequence Blast
gene length
768 bp Sequence Blast
sulfonate uptake
aliphatic sulfonate [SW|ABC transporter] (binding protein)

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW|Importers] → [category|SW|Uptake of ions]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.4|Sulfur metabolism]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.4|Sulfur metabolism] → [category|SW|sulfur metabolism/ general]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    961,394 962,161

    The protein

    Protein family

  • [SW|ABC transporter superfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|3DC6A032B0F076A460FE2C3244D747CFC7583FE7|YtlC]
  • Structure

  • [PDB|1Q1B] (MalK from E. coli, 38% identity) [pubmed|14527411]
  • [SW|Localization]

  • associated to the membrane (via [protein|91EAC386AD3A373E7CDE0265AA23786ADC55558A|SsuC]) [Pubmed|10092453]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|11251850], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|50930C56C27D22715620A350220E3C56ADB41020|CymR]: repression, [Pubmed|16513748], in [regulon|50930C56C27D22715620A350220E3C56ADB41020|CymR regulon]
  • regulation

  • repressed in the presence of cysteine ([protein|search|CymR]) [Pubmed|16513748]
  • view in new tab

    Biological materials


  • MGNA-A249 (ygaL::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE08830 ([gene|675CE0BCA393E9C2795032F1C0FDE6AF08B77033|ssuB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTTTTATCCCTCTCTTTC, downstream forward: _UP4_ATATAGAAAGGGCGGAAGCG
  • BKK08830 ([gene|675CE0BCA393E9C2795032F1C0FDE6AF08B77033|ssuB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTTTTATCCCTCTCTTTC, downstream forward: _UP4_ATATAGAAAGGGCGGAAGCG
  • References

  • 15937167,11251850,10092453,16513748,9782504,14527411