SubtiBank SubtiBank
bstC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

bstC

bacillithiol S-transferase, similar to nuclease inhibitor
locus
BSU_10860
pI
5.73
mw
19.34 kDa
protein length
169 aa Sequence Blast
gene length
510 bp Sequence Blast
function
unknown
product
bacillithiol S-transferase
essential
no
synonyms
yisT,yucH

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.8|Genetics/ other/ based on similarity]
  • Gene

    Coordinates
    1,165,449 1,165,958

    The protein

    Protein family

  • [SW|S-transferase-like (STL) superfamily] [pubmed|29451913]
  • [SW|DinB family] (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|67352C9D92DEB703C2FC90D676AFAA3DA276BF75|bstC]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B202 (yisT::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1201 NBRP B. subtilis, Japan]
  • BKE10860 ([gene|67352C9D92DEB703C2FC90D676AFAA3DA276BF75|bstC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE10860 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAGCATGCCCCCTTTTC, downstream forward: _UP4_TAAAATGCCCTTGCTTTTTT
  • BKK10860 ([gene|67352C9D92DEB703C2FC90D676AFAA3DA276BF75|bstC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK10860 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAGCATGCCCCCTTTTC, downstream forward: _UP4_TAAAATGCCCTTGCTTTTTT
  • References

    Research papers

  • 29451913