SubtiBank SubtiBank
yneB [2018-09-26 10:36:58]
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yneB [2018-09-26 10:36:58]

similar to resolvase
locus
BSU17870
pI
6.64
mw
24.59 kDa
protein length
217 aa Sequence Blast
gene length
651 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.6|DNA repair/ recombination/ based on similarity]
  • Gene

    Coordinates
    1,918,742 → 1,919,395

    Phenotypes of a mutant

  • increased sensitivity to DNA-damaging agents [Pubmed|23728628]
  • Expression and Regulation

    Operons

    genes
    [gene|7BF591DCDC9635C605D76135481A8A9DB63EE861|yneA]-[gene|67074435B8FDA85C8ED4D8C4ECE3580C4EDFBF2A|yneB]-[gene|5BFD552F8A467C8D95FABE87CC8C5E7F04114886|ynzC]
    description
    [Pubmed|12581363]

    regulatory mechanism

  • [protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA]: repression, [Pubmed|12581363], in [regulon|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA regulon]
  • regulation

  • induced by DNA damage ([protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA]) [Pubmed|12581363]
  • additional information

  • YneA is rapidly degraded by extracellular proteases ([protein|5ED8301B9681FDD5171A9344A971E891493A6558|CtpA]) [PubMed|29979679,20400548]
  • view in new tab

    Biological materials

    Mutant

  • BKE17870 (Δ[gene|67074435B8FDA85C8ED4D8C4ECE3580C4EDFBF2A|yneB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE17870 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTATCTCTCTTTCCTC, downstream forward: _UP4_TGAATCAGTTGTAAAACTTT
  • BKK17870 (Δ[gene|67074435B8FDA85C8ED4D8C4ECE3580C4EDFBF2A|yneB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK17870 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTATCTCTCTTTCCTC, downstream forward: _UP4_TGAATCAGTTGTAAAACTTT
  • References

  • 12581363,16267290,23728628