SubtiBank SubtiBank
yneB
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yneB

similar to resolvase
locus
BSU_17870
pI
6.64
mw
24.59 kDa
protein length
217 aa Sequence Blast
gene length
654 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.6|DNA repair/ recombination/ based on similarity]
  • Gene

    Coordinates
    1,918,742 1,919,395

    Phenotypes of a mutant

  • increased sensitivity to DNA-damaging agents [Pubmed|23728628]
  • The protein

    Protein family

  • [SW|site-specific recombinase resolvase family] (according to UniProt)
  • [SW|Domains]

  • [SW|Resolvase/invertase-type recombinase catalytic domain] (aa 2-147) (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|7BF591DCDC9635C605D76135481A8A9DB63EE861|yneA]-[gene|67074435B8FDA85C8ED4D8C4ECE3580C4EDFBF2A|yneB]-[gene|5BFD552F8A467C8D95FABE87CC8C5E7F04114886|ynzC]
    description
    [Pubmed|12581363]

    regulatory mechanism

  • [protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA]: repression, [Pubmed|12581363], in [regulon|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA regulon]
  • regulation

  • induced by DNA damage ([protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA]) [Pubmed|12581363]
  • additional information

  • YneA is rapidly degraded by extracellular proteases ([protein|5ED8301B9681FDD5171A9344A971E891493A6558|CtpA]) [PubMed|29979679,20400548]
  • view in new tab

    Biological materials

    Mutant

  • BKE17870 ([gene|67074435B8FDA85C8ED4D8C4ECE3580C4EDFBF2A|yneB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE17870 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTATCTCTCTTTCCTC, downstream forward: _UP4_TGAATCAGTTGTAAAACTTT
  • BKK17870 ([gene|67074435B8FDA85C8ED4D8C4ECE3580C4EDFBF2A|yneB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK17870 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTATCTCTCTTTCCTC, downstream forward: _UP4_TGAATCAGTTGTAAAACTTT
  • References

  • 12581363,16267290,23728628