SubtiBank SubtiBank
yneB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yneB

similar to resolvase
locus
BSU_17870
pI
6.64
mw
24.59 kDa
protein length
217 aa Sequence Blast
gene length
654 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.6|DNA repair/ recombination/ based on similarity]
  • Gene

    Coordinates
    1,918,742 1,919,395

    Phenotypes of a mutant

  • increased sensitivity to DNA-damaging agents [Pubmed|23728628]
  • The protein

    Protein family

  • [SW|site-specific recombinase resolvase family] (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|7BF591DCDC9635C605D76135481A8A9DB63EE861|yneA]-[gene|67074435B8FDA85C8ED4D8C4ECE3580C4EDFBF2A|yneB]-[gene|5BFD552F8A467C8D95FABE87CC8C5E7F04114886|ynzC]
    description
    [Pubmed|12581363]

    regulatory mechanism

  • [protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA]: repression, [Pubmed|12581363], in [regulon|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA regulon]
  • regulation

  • induced by DNA damage ([protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA]) [Pubmed|12581363]
  • additional information

  • YneA is rapidly degraded by extracellular proteases ([protein|5ED8301B9681FDD5171A9344A971E891493A6558|CtpA]) [PubMed|29979679,20400548]
  • view in new tab

    Biological materials

    Mutant

  • BKE17870 ([gene|67074435B8FDA85C8ED4D8C4ECE3580C4EDFBF2A|yneB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE17870 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTATCTCTCTTTCCTC, downstream forward: _UP4_TGAATCAGTTGTAAAACTTT
  • BKK17870 ([gene|67074435B8FDA85C8ED4D8C4ECE3580C4EDFBF2A|yneB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK17870 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTATCTCTCTTTCCTC, downstream forward: _UP4_TGAATCAGTTGTAAAACTTT
  • References

  • 12581363,16267290,23728628