SubtiBank SubtiBank
ydhF
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ydhF

unknown
locus
BSU_05730
pI
6.16
mw
26.38 kDa
protein length
236 aa Sequence Blast
gene length
711 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    Coordinates
    619,321 620,031

    The protein

    [SW|Domains]

  • [SW|DUF4352] (aa 84 ... 190) (according to UniProt)
  • [SW|Localization]

  • extracellular (signal peptide) [Pubmed|18957862], lipid modification as retention signal
  • Expression and Regulation

    Operons

    genes
    [gene|3B95AB3021280215B6B487A348D78FB5797AEEA6|phoB]-[gene|66D3E978E3DBA0410CA5597B5B860DF27C97335A|ydhF]
    description
    [Pubmed|10913081]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190,16030210], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP]: activation, [Pubmed|9335276,10913081,16030210], in [regulon|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP regulon]
  • regulation

  • expressed under conditions of phosphate limitation ([protein|search|PhoP]) [Pubmed|9335276,10913081,16030210]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C181 (ydhF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2179 NBRP B. subtilis, Japan]
  • BKE05730 ([gene|66D3E978E3DBA0410CA5597B5B860DF27C97335A|ydhF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE05730 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATGATTCCTCCATTAA, downstream forward: _UP4_TAAATCAAGAACTCCCGTAC
  • BKK05730 ([gene|66D3E978E3DBA0410CA5597B5B860DF27C97335A|ydhF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK05730 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATGATTCCTCCATTAA, downstream forward: _UP4_TAAATCAAGAACTCCCGTAC
  • References

  • 16030210,9335276,10913081,18957862