SubtiBank SubtiBank
yomF [2018-11-19 17:59:07]
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yomF [2018-11-19 17:59:07]

31.60 kDa
protein length
273 aa Sequence Blast
gene length
819 bp Sequence Blast

Genomic Context



  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.2|SP-beta prophage]
  • Gene

    2,259,475 → 2,260,296

    The protein

    Protein family

  • mtrB family (according to Swiss-Prot)
  • Biological materials


  • BKE21380 (Δ[gene|66A43FFBB0657656E6D1790CB2444DAA87A653C1|yomF]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATCAGCCAGTTTAGTTCACC, downstream forward: _UP4_TAAGATCCCCTCCGGGATCT
  • BKK21380 (Δ[gene|66A43FFBB0657656E6D1790CB2444DAA87A653C1|yomF]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATCAGCCAGTTTAGTTCACC, downstream forward: _UP4_TAAGATCCCCTCCGGGATCT