SubtiBank SubtiBank
yomF
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yomF

unknown
locus
BSU_21380
pI
4.50
mw
31.60 kDa
protein length
273 aa Sequence Blast
gene length
822 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.2|SP-beta prophage]
  • Gene

    Coordinates
    2,259,475 2,260,296

    Biological materials

    Mutant

  • BKE21380 ([gene|66A43FFBB0657656E6D1790CB2444DAA87A653C1|yomF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE21380 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATCAGCCAGTTTAGTTCACC, downstream forward: _UP4_TAAGATCCCCTCCGGGATCT
  • BKK21380 ([gene|66A43FFBB0657656E6D1790CB2444DAA87A653C1|yomF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK21380 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATCAGCCAGTTTAGTTCACC, downstream forward: _UP4_TAAGATCCCCTCCGGGATCT