SubtiBank SubtiBank
spoVID
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

spoVID

spore coat morphogenetic protein, non-competitive hub during spore encasement, promotes encasement of the spore
locus
BSU_28110
pI
4.00
mw
64.80 kDa
protein length
575 aa Sequence Blast
gene length
1728 bp Sequence Blast
function
spore coat assembly
product
spore coat morphogenetic protein
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.1|Spore coat proteins] → [category|SW 4.2.1.1.1|Class I]
  • Gene

    Coordinates
    2,871,022 2,872,749

    Phenotypes of a mutant

  • accumulation of [protein|CEBEC9CECCF445C40D793E61A2CD23175631A473|SafA] and [protein|825AD8D4315A85CD384F9AF6AD894E38E57C88F7|CotE] and their dependent proteins at the mother cell proximal spore pole [pubmed|30168214]
  • The protein

    [SW|Domains]

  • contains a N-acetylglucosamine-polymer-binding [SW|LysM domain] (aa 523-567) [Pubmed|18430080]
  • [SW|LysM domain] (aa 523-567) (according to UniProt)
  • [SW|Localization]

  • spore coat (basement), localization depends on [protein|A25C1530DA7BB007A288E525404E9F775E219FE8|SpoIVA] [Pubmed|22773792,22171814]
  • Expression and Regulation

    Operons

    genes
    [gene|6698BB092E03BEF48AFD0CBF565410109CD1ABB5|spoVID]-[gene|D1EAEC9C88EDDD8FB2E7E315DE28A7A54AAAB4D2|ysxE]
    description
    [Pubmed|15699190,8449878]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190,8449878], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulation

  • expressed early during sporulation in the mother cell ([protein|search|SigE]) [Pubmed|15699190,8449878]
  • view in new tab

    Biological materials

    Mutant

  • 1A639 ( ''spoVID''::''erm''), [Pubmed|3015878], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A639&Search=1A639 BGSC]
  • 1S127 ( ''spoVID''::''erm''), [Pubmed|16751597], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1S127&Search=1S127 BGSC]
  • BKE28110 ([gene|6698BB092E03BEF48AFD0CBF565410109CD1ABB5|spoVID]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE28110 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGTTCATATCCTCCTTTC, downstream forward: _UP4_TAAACCGTAAGTGATCGGAA
  • BKK28110 ([gene|6698BB092E03BEF48AFD0CBF565410109CD1ABB5|spoVID]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK28110 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGTTCATATCCTCCTTTC, downstream forward: _UP4_TAAACCGTAAGTGATCGGAA
  • labs

  • [SW|Adriano Henriques], Lisbon, Portugal [http://www.itqb.unl.pt/research/biology/microbial-development homepage]
  • [SW|Charles Moran], Emory University, NC, USA [http://www.microbiology.emory.edu/moran_c.html homepage]
  • References

    Reviews

  • 23202530,18430080
  • Original publications

  • 16950916,11325931,12107147,10714986,19775244,15699190,8449878,22773792,22171814,23178679,25259857,19702880,22262582,26187959,30168214,30455281