SubtiBank SubtiBank
citA [2019-06-26 09:37:40]
Don't miss! The Virtual International Conference on Bacillus will take place from June 8 to June 12! Website

citA [2019-06-26 09:37:40]

minor citrate synthase
40.78 kDa
protein length
366 aa Sequence Blast
gene length
1101 bp Sequence Blast
minor citrate synthase

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    1,021,057 1,022,157

    The protein

    Catalyzed reaction/ biological activity

  • Acetyl-CoA + H2O + oxaloacetate = citrate + CoA (according to Swiss-Prot)
  • Protein family

  • citrate synthase family (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|3DB116F7423C31838ED6EE090B94DA5F93A4F40C|MmgD], [protein|58E3A065A95D03B4FB1F544906F53D1704D29EAD|CitZ]
  • Structure

  • [PDB|2C6X]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8045898], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E7E0B170D1EEECE4E4EDC29B0399CB48253E9A17|CitR]: repression, [Pubmed|8045899], in [regulon|E7E0B170D1EEECE4E4EDC29B0399CB48253E9A17|CitR regulon]
  • regulation

  • induced by stress ([protein|search|SigB]) [Pubmed|11544224]
  • view in new tab

    Biological materials


  • GP676 (erm), available in [SW|Jörg Stülke]'s lab
  • GP1282 Δ''[gene|6684F6083B001E9FDC5967799B715AE966B83E1D|citA]''::''cat'', available in [SW|Jörg Stülke]'s lab
  • GP1753 Δ(''[gene|E7E0B170D1EEECE4E4EDC29B0399CB48253E9A17|citR] [gene|6684F6083B001E9FDC5967799B715AE966B83E1D|citA]'')::''aphA3'', the resistance cassette can be cut out by introducing the ''cre''-rekombinase into the chromosom of ''B. subtilis'', available in [SW|Jörg Stülke]'s lab
  • GP2360 Δ(''[gene|E7E0B170D1EEECE4E4EDC29B0399CB48253E9A17|citR] [gene|6684F6083B001E9FDC5967799B715AE966B83E1D|citA])''::''erm'', the resistance cassette can be cut out by introducing the ''cre''-rekombinase into the chromosom of ''B. subtilis'', available in [SW|Jörg Stülke]'s lab
  • BKE09440 ([gene|6684F6083B001E9FDC5967799B715AE966B83E1D|citA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGTATTCCCCCTATCC, downstream forward: _UP4_TAACATATTTTGGCGTTTAT
  • BKK09440 ([gene|6684F6083B001E9FDC5967799B715AE966B83E1D|citA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGTATTCCCCCTATCC, downstream forward: _UP4_TAACATATTTTGGCGTTTAT
  • Expression vectors

  • pGP2516 (N-terminal Strep-tag, purification from ''E. coli'', in [SW|pGP172]), available in [SW|Jörg Stülke]'s lab
  • FLAG-tag construct

  • GP1287 (''spc'', based on [SW|pGP1331]), available in [SW|Jörg Stülke]'s lab
  • References

  • 8045899,8045898,22383849