SubtiBank SubtiBank
citA [2019-02-05 09:41:50]
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

citA [2019-02-05 09:41:50]

minor citrate synthase
locus
BSU09440
pI
5.78
mw
40.78 kDa
protein length
366 aa Sequence Blast
gene length
1101 bp Sequence Blast
function
unknown
product
minor citrate synthase
essential
no
ec
2.3.3.1
synonyms
citA1

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    1,021,057 1,022,157

    The protein

    Catalyzed reaction/ biological activity

  • Acetyl-CoA + H2O + oxaloacetate = citrate + CoA (according to Swiss-Prot)
  • Protein family

  • citrate synthase family (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|3DB116F7423C31838ED6EE090B94DA5F93A4F40C|MmgD], [protein|58E3A065A95D03B4FB1F544906F53D1704D29EAD|CitZ]
  • Structure

  • [PDB|2C6X]
  • Expression and Regulation

    Operons

    genes
    [gene|6684F6083B001E9FDC5967799B715AE966B83E1D|citA]-[gene|EAEEA4DD9641919830A81185333A2610B964D37C|yhdF]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8045898], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E7E0B170D1EEECE4E4EDC29B0399CB48253E9A17|CitR]: repression, [Pubmed|8045899], in [regulon|E7E0B170D1EEECE4E4EDC29B0399CB48253E9A17|CitR regulon]
  • regulation

  • induced by stress ([protein|search|SigB]) [Pubmed|11544224]
  • view in new tab

    Biological materials

    Mutant

  • GP676 (erm), available in [SW|Jörg Stülke]'s lab
  • GP1282 (''[gene|6684F6083B001E9FDC5967799B715AE966B83E1D|citA]'')::''cat'', available in [SW|Jörg Stülke]'s lab
  • GP1753 Δ(''[gene|E7E0B170D1EEECE4E4EDC29B0399CB48253E9A17|citR] [gene|6684F6083B001E9FDC5967799B715AE966B83E1D|citA]'')::''aphA3'', the resistance cassette can be cut out by introducing the ''cre''-rekombinase into the chromosom of ''B. subtilis'', available in [SW|Jörg Stülke]'s lab
  • GP2360 Δ(''[gene|E7E0B170D1EEECE4E4EDC29B0399CB48253E9A17|citR] [gene|6684F6083B001E9FDC5967799B715AE966B83E1D|citA])''::''erm'', the resistance cassette can be cut out by introducing the ''cre''-rekombinase into the chromosom of ''B. subtilis'', available in [SW|Jörg Stülke]'s lab
  • BKE09440 ([gene|6684F6083B001E9FDC5967799B715AE966B83E1D|citA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE09440 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGTATTCCCCCTATCC, downstream forward: _UP4_TAACATATTTTGGCGTTTAT
  • BKK09440 ([gene|6684F6083B001E9FDC5967799B715AE966B83E1D|citA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK09440 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGTATTCCCCCTATCC, downstream forward: _UP4_TAACATATTTTGGCGTTTAT
  • Expression vectors

  • pGP2516 (N-terminal Strep-tag, purification from ''E. coli'', in [SW|pGP172]), available in [SW|Jörg Stülke]'s lab
  • FLAG-tag construct

  • GP1287 (''spc'', based on [SW|pGP1331]), available in [SW|Jörg Stülke]'s lab
  • References

  • 8045899,8045898,22383849