SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


acetyl-CoA synthetase
64.72 kDa
protein length
572 aa Sequence Blast
gene length
1719 bp Sequence Blast
utilization of acetate, fatty acids
acetyl-CoA synthetase)

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of organic acids]
  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.1|Utilization of lipids] → [category|SW|Utilization of fatty acids]
  • Gene

    3,038,213 3,039,931

    The protein

    Catalyzed reaction/ biological activity

  • acetate + ATP + CoA --> acetyl-CoA + AMP + diphosphate (according to UniProt)
  • Protein family

  • [SW|ATP-dependent AMP-binding enzyme family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|48538F67259B25B64A7BC4263E944C7074E8E1B3|YtcI]:
  • Modification

  • acetylated on Lys-549 by [protein|17C3F56CE859BCD7A282C144C46CC92D3506ABF6|AcuA], this results in inactivation [Pubmed|18487328], deacetylated by [protein|A0A6CB19191A251BB5600C18E039978A9A34933C|SrtN] and [protein|1255813797A83D835E0656A2AAAD361B5BB2094B|AcuC] deacetylates (and thereby activates) [protein|6671E7D85E99D349679F0E9D825DC035D10FFD2E|AcsA] [Pubmed|19136592]
  • Structure

  • [PDB|2P2F] (from ''Salmonella enterica'', 37% identity) [Pubmed|17497934]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|7913927], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|7913927], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|12618455,18083814], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • regulation

  • repressed by glucose (4.5-fold) ([protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]) [Pubmed|7913927,12850135]
  • view in new tab


    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [pubmed|7913927], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [pubmed|7913927], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [pubmed|12618455,18083814], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • regulation

  • repressed by glucose (4.5-fold) ([protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]) [Pubmed|7913927,12850135]
  • view in new tab

    Biological materials


  • GP1212 (''acsA''::''kan''), available in [SW|Jörg Stülke]'s lab
  • BKE29680 ([gene|6671E7D85E99D349679F0E9D825DC035D10FFD2E|acsA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCCCAAACATCCCCCTT, downstream forward: _UP4_ACAATGGAGGATTAAAAGGC
  • BKK29680 ([gene|6671E7D85E99D349679F0E9D825DC035D10FFD2E|acsA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCCCAAACATCCCCCTT, downstream forward: _UP4_ACAATGGAGGATTAAAAGGC
  • References


  • 15316652,31091420
  • Original publications

  • 7934817,7913927,18083814,17303131,12618455,19136592,18487328,12850135,16855235,22900538,17497934,29093482