SubtiBank SubtiBank
ecsB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ecsB

[SW|ABC transporter] ( membrane protein)
locus
BSU_10050
pI
10.18
mw
47.14 kDa
protein length
408 aa Sequence Blast
gene length
1227 bp Sequence Blast
function
regulation of the secretion apparatus and of intra-membrane proteolysis
product
[SW|ABC transporter] ( membrane protein)
essential
no
synonyms
prsT,yhaC

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.3|Regulatory ABC transporters]
  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.5|Protein secretion]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW 3.4.1.2|Control of sigma factors]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,078,176 1,079,402

    Phenotypes of a mutant

  • inactivation of ''[gene|665BE3614B466067D64D1FB275ECDDE12CBFC9D4|ecsB]'' reduces sporulation efficiency to 13.4% that of wild type cells [Pubmed|26735940]
  • no processing of [protein|4E720917045032E8B45CB8AF6E5C13AE0E48EE33|RsiW] and [protein|79712F4CF884A660C71B45B3397AEFA5C0AFA683|FtsL], impaired activity of [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW] [pubmed|29343670]
  • The protein

    [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|59A7B26F810D7FEB07C176A8B2ECF6B83803DE49|ecsA]-[gene|665BE3614B466067D64D1FB275ECDDE12CBFC9D4|ecsB]-[gene|6D07C98A82C8960133BC50E40EF5D56A21071316|ecsC]
    description
    [pubmed|22383849]
    view in new tab

    additional information

  • the mRNA is very stable (> 15 min) [pubmed|12884008]
  • Biological materials

    Mutant

  • BKE10050 ([gene|665BE3614B466067D64D1FB275ECDDE12CBFC9D4|ecsB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE10050 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CCGCGACTGCCAAATATCAA, downstream forward: _UP4_CTGTGAACTGAAAAGAGGTA
  • BKK10050 ([gene|665BE3614B466067D64D1FB275ECDDE12CBFC9D4|ecsB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK10050 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CCGCGACTGCCAAATATCAA, downstream forward: _UP4_CTGTGAACTGAAAAGAGGTA
  • References

    Reviews

  • 29343670
  • Original publications

  • 8581172,15175311,10092453,18599827,10027970,12884008,26735940