SubtiBank SubtiBank
uvrC
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

uvrC

excinuclease ABC (subunit C), required for transcription-dependent asymmetry in mutation rates of genes in the two orientations
locus
BSU_28490
pI
9.50
mw
69.28 kDa
protein length
590 aa Sequence Blast
gene length
1773 bp Sequence Blast
function
DNA repair after UV damage
product
excinuclease ABC (subunit C)
essential
no
synonyms
uvrB

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW 3.1.5.6|Other proteins]
  • Gene

    Coordinates
    2,911,116 2,912,888

    The protein

    Protein family

  • uvrC family (single member, according to UniProt)
  • [SW|Domains]

  • [SW|GIY-YIG-domain] (aa 14-91) (according to UniProt)
  • [SW|UVR domain] (aa 196-231) (according to UniProt)
  • Structure

  • [PDB|3C65] (5' endonuclease domain, Geobacillus stearothermophilus)
  • Expression and Regulation

    Operons

    genes
    [gene|6624AA675E9E52FFABFF26055F63471AEF881CC5|uvrC]
    description
    [Pubmed|16267290]

    regulatory mechanism

  • [protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA]: repression, [Pubmed|16267290]], in [regulon|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA regulon]
  • regulation

  • induced upon DNA damage ([protein|search|LexA]) [Pubmed|16267290]
  • view in new tab

    Biological materials

    Mutant

  • GP3542 (Δ[gene|6624AA675E9E52FFABFF26055F63471AEF881CC5|uvrC]::kan), available in [SW|Jörg Stülke]'s lab
  • BKE28490 ([gene|6624AA675E9E52FFABFF26055F63471AEF881CC5|uvrC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE28490 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGTTACCCTTCCTTAT, downstream forward: _UP4_TAATGTTGTCCTTTTAAATA
  • BKK28490 ([gene|6624AA675E9E52FFABFF26055F63471AEF881CC5|uvrC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK28490 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGTTACCCTTCCTTAT, downstream forward: _UP4_TAATGTTGTCCTTTTAAATA
  • References

    Reviews

  • 16464004,15927210,7801120,22933559
  • Original publications

  • 2174442,2559145,16267290,25713353