SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


Na+-coupled [protein|3D42584D65D80A1C73F057714647E29FF6BBD58A|MotP]-[protein|search|MotS ]flagellar stator
27.45 kDa
protein length
242 aa Sequence Blast
gene length
729 bp Sequence Blast
[SW|motility and chemotaxis]
motility protein (flagellar motor rotation)

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.1|Motility and chemotaxis] → [category|SW|Flagellar proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,042,566 3,043,294

    The protein

    Protein family

  • MotB family (with [protein|FE56753D061344B0F10A6523F49C5C7356AA40B6|MotB], according to UniProt)
  • Paralogous protein(s)

  • [protein|FE56753D061344B0F10A6523F49C5C7356AA40B6|MotB]
  • [SW|Domains]

  • a single trans-membrane helix [pubmed|29109979]
  • C-terminal extracytoplasmic peptidoglycan-binding domain [pubmed|29109979]
  • [SW|Localization]

  • cell membrane, the larger portion of the protein is exposed to the extracellular space [pubmed|29109979]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulation

  • constitutive
  • view in new tab

    Biological materials


  • MGNA-B525 (ytxE::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE29720 ([gene|6617D785D08C5919F0B774D2AF9EA6A84215486B|motS]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATTCCTTCTTTCAAAACGTT, downstream forward: _UP4_ACGACCTCTTCGTAAAGGTC
  • BKK29720 ([gene|6617D785D08C5919F0B774D2AF9EA6A84215486B|motS]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATTCCTTCTTTCAAAACGTT, downstream forward: _UP4_ACGACCTCTTCGTAAAGGTC
  • References

  • 16095621,15306009,23049994,16547058,25273986,28378843,29109979,,16095621