SubtiBank SubtiBank
epsK
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

epsK

export of extracellular poly-N-acetylglucosamine
locus
BSU_34265
pI
10.00
mw
55.00 kDa
protein length
505 aa Sequence Blast
gene length
1518 bp Sequence Blast
function
export of extracellular poly-N-acetylglucosamine
product
poly-N-acetylglucosamine exporter
essential
no
synonyms
yvfA,yvfB

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.11|Other exporters]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW 4.1.2.1|Matrix polysaccharide synthesis]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,517,485 3,519,002

    Phenotypes of a mutant

  • smooth colonies on MsGG medium, no [SW|biofilm formation] [Pubmed|22113911]
  • The protein

    Protein family

  • [SW|MOP exporter family]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|F6C4634BF871D9A01E27014FFED7527C54BF560D|epsA]-[gene|9B668909E1380B287ACE58561DCF45FC29184D8B|epsB]-[gene|5DB168A3D087AAEB003D7548A1A4356ABD07F712|epsC]-[gene|223E979276F07D69D0DDAEE906023A8AB4F37F8E|epsD]-[gene|5D717F9F54693FD0AA8BC49E10348637858F88B9|epsE]-[gene|DB47BA2A5E3BED51DD8630E7D321C099D74B46CF|epsF]-[gene|C4D81976AAE888C4FE89A2EE5CF9A763CAD645FF|epsG]-[gene|BD843389F95BFB905071547AB243413A617F12A8|epsH]-[gene|6EBD8F7065B6C1996067F3120DD9CFEA91D3A444|epsI]-[gene|5272E807B6B98541EA155AA9748320E25767F096|epsJ]-[gene|66076952E512D53FC1FC62455A86ACFA21AE120D|epsK]-[gene|D67665412B78B56752B460219445E4BEF52C3A1A|epsL]-[gene|40EA584CF77FFF7D7E4E74B414EC69ADE3A1585B|epsM]-[gene|0D24AB8D446CFFBC6DEAD3C10D1FA59551545FE8|epsN]-[gene|52A47B49B1FB955EE7E3C316B57A2B4134F78480|epsO]
    description
    [Pubmed|15661000]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|15661000], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|RemA]: activation, [Pubmed|23646920], in [regulon|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|RemA regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR]: anti-activation, (prevents binding of [protein|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|RemA]) [Pubmed|23646920], in [regulon|5A6FBAE6553343092862CB79E150F934978C32A9|SinR regulon]
  • [regulon|EAR riboswitch|EAR riboswitch]: processive antitermination, in [regulon|EAR riboswitch|EAR riboswitch]
  • regulation

  • repressed by [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR] [Pubmed|15661000]
  • additional information

  • induction by sequestration of [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR] by [protein|24D6A7DDCB25B99FBB670E9203F826596916B35C|SinI] or [protein|C17C296F3EB2E106C380E3B5D784F3FA63F4C9B7|SlrA] [PubMed|15661000,19788541]
  • expression is increased in [gene|21D260E900776EAAF4B6000A3365DCA9241EACA6|rsiX] mutants [pubmed|32483306]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B611 (yvfA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1610 NBRP B. subtilis, Japan]
  • BKE34265 ([gene|66076952E512D53FC1FC62455A86ACFA21AE120D|epsK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE34265 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGCGCTGAAATTTATCGTGA, downstream forward: _UP4_AAAACGAAAGGAGCTGTGAA
  • BKK34265 ([gene|66076952E512D53FC1FC62455A86ACFA21AE120D|epsK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK34265 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGCGCTGAAATTTATCGTGA, downstream forward: _UP4_AAAACGAAAGGAGCTGTGAA
  • labs

  • [SW|Richard Losick], Harvard Univ., Cambridge, USA [http://www.mcb.harvard.edu/Losick/ homepage]
  • References

    Reviews

  • 20735481
  • The EAR [SW|RNA switch]

  • 20374491,20230605