SubtiBank SubtiBank
licB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

licB

lichenan-specific permease of the [SW|phosphotransferase systems|phosphotransferase system], EIIB of the [category|SW 1.2.2|PTS], [category|SW 3.4.3|Trigger enzyme], control of [protein|E087ABA705CE94E2CAD44A0F2FB265B0F7B04399|LicR] activity
locus
BSU38590
pI
6.31
mw
10.82 kDa
protein length
102 aa Sequence Blast
gene length
309 bp Sequence Blast
function
lichenan uptake and phosphorylation, control of LicR activity
product
lichenan-specific [category|SW 1.2.2|PTS], EIIB component
essential
no
ec
2.7.1.69
synonyms
celA

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.2|Phosphotransferase system] → [category|SW 1.2.2.2|Sugar specific PTS proteins]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.27|Utilization of other polymeric carbohydrates]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.4|Control of PRD-type regulators]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.3|Trigger enzyme] → [category|SW 3.4.3.1|Trigger enzymes of the PTS that control the activity of PRD-containing transcription factors]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.3|Phosphorylation on a Cys residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]
  • Gene

    Coordinates
    3,961,566 3,961,874

    The protein

    Catalyzed reaction/ biological activity

  • Protein EIIB N(pi)-phospho-L-histidine/cysteine + sugar = protein EIIB + sugar phosphate (according to Swiss-Prot)
  • Protein family

  • [category|SW 1.2.2|PTS] permease, lactose family [Pubmed|10627040]
  • Paralogous protein(s)

  • [protein|00A4A90685CED4AD46829C45718CF26F1D62F5D3|GmuB]
  • Modification

  • phosphorylation on Ser-37 [Pubmed|17218307]
  • Structure

  • [PDB|1e2b] (from ''E. coli'', 40% identity) [Pubmed|9041631]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|65FC7F4ED92F747DB7BC5672DCA2D2320A471134|licB]-[gene|83A7C160B0301A2B51B65478D99ACB753D67AF74|licC]-[gene|E8B6C8E722BEE866878CDD816B7828C132F94FCD|licA]-[gene|84D8AA0AFBF46273F6B4198B49440D55470FEC0F|licH]
    description
    [Pubmed|8990303]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8990303], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|8990303], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|E087ABA705CE94E2CAD44A0F2FB265B0F7B04399|LicR]: activation, [Pubmed|8990303], in [regulon|E087ABA705CE94E2CAD44A0F2FB265B0F7B04399|LicR regulon]
  • regulation

  • carbon catabolite repression ([protein|search|CcpA]) [Pubmed|8990303]
  • view in new tab

    Biological materials

    Mutant

  • BKE38590 ([gene|65FC7F4ED92F747DB7BC5672DCA2D2320A471134|licB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE38590 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTAAAAGACCCCCTAGA, downstream forward: _UP4_GTGTCATAGAGAGGGGCGGG
  • BKK38590 ([gene|65FC7F4ED92F747DB7BC5672DCA2D2320A471134|licB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK38590 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTAAAAGACCCCCTAGA, downstream forward: _UP4_GTGTCATAGAGAGGGGCGGG
  • References

  • 19087206,8990303,16872404,10438772,10627040,17218307,8990303,9041631