SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


[protein|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK] repressor, stimulates degradation of the [gene|search|comK ]mRNA
17.75 kDa
protein length
154 aa Sequence Blast
gene length
465 bp Sequence Blast
control of [protein|search|ComK ]accumulation and of bistable competence gene expression
[protein|search|ComK ]repressor

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.7|Genetic competence]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.3|Genetic competence]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    1,474,560 1,475,024

    The protein

    Catalyzed reaction/ biological activity

  • stimulates [protein|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK] mRNA degradation [Pubmed|26110430]
  • controls stability of several mRNAs (see [SW|Kre regulon]) [Pubmed|26110430]
  • [SW|Localization]

  • cytoplasm [Pubmed|26110430]
  • Expression and Regulation



    regulatory mechanism

  • [protein|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK]: repression, [Pubmed|26110430], in [regulon|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK regulon]
  • regulation

  • repressed in competent cells ([SW|ComK]) [Pubmed|26110430]
  • view in new tab

    Biological materials


  • MGNA-A764 (ykyB::erm), available at the [ NBRP B. subtilis, Japan]
  • PG479 (ykyB::erm), available in [SW|Leendert Hamoen]'s and [SW|Jörg Stülke]'s labs [Pubmed|26110430]
  • GP2533 ([gene|65E2F7197D46F5C884CC96018EE4F3EEE94FFA18|kre]::''erm''), available in [SW|Jörg Stülke]'s lab
  • BKE14020 ([gene|65E2F7197D46F5C884CC96018EE4F3EEE94FFA18|kre]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATTTCTCTCCTTTGCT, downstream forward: _UP4_TAAAATAAAAACAGCCGTGC
  • BKK14020 ([gene|65E2F7197D46F5C884CC96018EE4F3EEE94FFA18|kre]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATTTCTCTCCTTTGCT, downstream forward: _UP4_TAAAATAAAAACAGCCGTGC
  • References


  • 26110607
  • Original Publications

  • 8169223,26110430