SubtiBank SubtiBank
dgkA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

dgkA

undecaprenol kinase
locus
BSU25310
pI
7.13
mw
12.40 kDa
protein length
123 aa Sequence Blast
gene length
372 bp Sequence Blast
function
cell wall biosynthesis
product
undecaprenol kinase
essential
no
ec
2.7.1.107
synonyms
yqxF

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.1|Cell wall synthesis] → [category|SW 1.1.1.3|Biosynthesis of lipoteichoic acid]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.1|Biosynthesis of cell wall components] → [category|SW 2.6.1.2|Biosynthesis of lipoteichoic acid]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,611,456 2,611,827

    Phenotypes of a mutant

  • inactivation of ''[gene|65D3306FE372FF730DD6C62B841AA80CA30AEA43|dgkA]'' reduces sporulation efficiency to 33.7% that of wild type cells [Pubmed|26735940]
  • The protein

    Protein family

  • Bacterial diacylglycerol kinase family (according to UniProt)
  • [SW|Localization]

  • cell membrane at the septum [Pubmed|15743965]
  • Biological materials

    Mutant

  • BKE25310 ([gene|65D3306FE372FF730DD6C62B841AA80CA30AEA43|dgkA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25310 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTGAAGAATCGATTCAGCT, downstream forward: _UP4_TAATGGCTGAAAATTCTTAC
  • BKK25310 ([gene|65D3306FE372FF730DD6C62B841AA80CA30AEA43|dgkA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25310 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTGAAGAATCGATTCAGCT, downstream forward: _UP4_TAATGGCTGAAAATTCTTAC
  • References

  • 12923107,17535816,15743965,26735940,29259598