SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


undecaprenol kinase
12.40 kDa
protein length
123 aa Sequence Blast
gene length
372 bp Sequence Blast
cell wall biosynthesis
undecaprenol kinase

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.1|Cell wall synthesis] → [category|SW|Biosynthesis of lipoteichoic acid]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.1|Biosynthesis of cell wall components] → [category|SW|Biosynthesis of lipoteichoic acid]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    2,611,456 2,611,827

    Phenotypes of a mutant

  • inactivation of ''[gene|65D3306FE372FF730DD6C62B841AA80CA30AEA43|dgkA]'' reduces sporulation efficiency to 33.7% that of wild type cells [Pubmed|26735940]
  • The protein

    Catalyzed reaction/ biological activity

  • ATP + di-trans,octa-cis-undecaprenol --> ADP + di-trans,octa-cis-undecaprenyl phosphate + H+ (according to UniProt)
  • Protein family

  • Bacterial diacylglycerol kinase family (single member, according to UniProt)
  • [SW|Localization]

  • cell membrane at the septum [Pubmed|15743965]
  • Biological materials


  • BKE25310 ([gene|65D3306FE372FF730DD6C62B841AA80CA30AEA43|dgkA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTGAAGAATCGATTCAGCT, downstream forward: _UP4_TAATGGCTGAAAATTCTTAC
  • BKK25310 ([gene|65D3306FE372FF730DD6C62B841AA80CA30AEA43|dgkA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTGAAGAATCGATTCAGCT, downstream forward: _UP4_TAATGGCTGAAAATTCTTAC
  • References

  • 12923107,17535816,15743965,26735940,29259598