SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


undecaprenol kinase
12.40 kDa
protein length
123 aa Sequence Blast
gene length
372 bp Sequence Blast
cell wall biosynthesis
undecaprenol kinase

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.1|Cell wall synthesis] → [category|SW|Biosynthesis of lipoteichoic acid]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.1|Biosynthesis of cell wall components] → [category|SW|Biosynthesis of lipoteichoic acid]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    2,611,456 2,611,827

    Phenotypes of a mutant

  • inactivation of ''[gene|65D3306FE372FF730DD6C62B841AA80CA30AEA43|dgkA]'' reduces sporulation efficiency to 33.7% that of wild type cells [Pubmed|26735940]
  • The protein

    Catalyzed reaction/ biological activity

  • ATP + di-trans,octa-cis-undecaprenol --> ADP + di-trans,octa-cis-undecaprenyl phosphate + H+ (according to UniProt)
  • Protein family

  • Bacterial diacylglycerol kinase family (single member, according to UniProt)
  • [SW|Localization]

  • cell membrane at the septum [Pubmed|15743965]
  • Biological materials


  • BKE25310 ([gene|65D3306FE372FF730DD6C62B841AA80CA30AEA43|dgkA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTGAAGAATCGATTCAGCT, downstream forward: _UP4_TAATGGCTGAAAATTCTTAC
  • BKK25310 ([gene|65D3306FE372FF730DD6C62B841AA80CA30AEA43|dgkA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTGAAGAATCGATTCAGCT, downstream forward: _UP4_TAATGGCTGAAAATTCTTAC
  • References

  • 12923107,17535816,15743965,26735940,29259598