SubtiBank SubtiBank
yeeF
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yeeF

polymorphic toxin, non-specific metal-dependent DNase
locus
BSU_06812
pI
8.94
mw
74.00 kDa
protein length
669 aa Sequence Blast
gene length
2010 bp Sequence Blast
function
competetion with other bacteria
product
non-specific metal-dependent DNase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.17|Toxins, antitoxins and immunity against toxins] → [category|SW 4.3.17.2|Type 2 TA systems]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.18|Toxins, antitoxins and immunity against toxins/ based on similarity]
  • Gene

    Coordinates
    747,554 749,563

    The protein

    Catalyzed reaction/ biological activity

  • non-specific metal-dependent DNase activity [pubmed|32117125]
  • [SW|Domains]

  • [SW|LXG domain] (aa 1-235) (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|655C07294D3A04763049D6701A7296BB4AF8E6B9|yeeF]-[gene|9202D58FAC1B7B9CF693D537A12C683A3573B17E|yezG]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A963 (yeeF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/963 NBRP B. subtilis, Japan]
  • BKE06812 ([gene|655C07294D3A04763049D6701A7296BB4AF8E6B9|yeeF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06812 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGACCATTTCCCTTCTTT, downstream forward: _UP4_TAGAAGAATGGAAACTAGGA
  • BKK06812 ([gene|655C07294D3A04763049D6701A7296BB4AF8E6B9|yeeF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06812 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGACCATTTCCCTTCTTT, downstream forward: _UP4_TAGAAGAATGGAAACTAGGA
  • References

  • 22200572,32117125