SubtiBank SubtiBank
yeeF
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yeeF

putative toxin
locus
BSU_06812
pI
8.94
mw
74.00 kDa
protein length
669 aa Sequence Blast
gene length
2010 bp Sequence Blast
function
unknown
product
putative toxin
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.17|Toxins, antitoxins and immunity against toxins] → [category|SW 4.3.17.2|Type 2 TA systems]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.18|Toxins, antitoxins and immunity against toxins/ based on similarity]
  • Gene

    Coordinates
    747,554 749,563

    Expression and Regulation

    Operons

    genes
    [gene|655C07294D3A04763049D6701A7296BB4AF8E6B9|yeeF]-[gene|9202D58FAC1B7B9CF693D537A12C683A3573B17E|yezG]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A963 (yeeF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/963 NBRP B. subtilis, Japan]
  • BKE06812 ([gene|655C07294D3A04763049D6701A7296BB4AF8E6B9|yeeF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06812 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGACCATTTCCCTTCTTT, downstream forward: _UP4_TAGAAGAATGGAAACTAGGA
  • BKK06812 ([gene|655C07294D3A04763049D6701A7296BB4AF8E6B9|yeeF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06812 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGACCATTTCCCTTCTTT, downstream forward: _UP4_TAGAAGAATGGAAACTAGGA
  • References

  • 22200572