SubtiBank SubtiBank
ycsD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ycsD

-hydroxyacyl-(acyl carrier protein) dehydratase
locus
BSU04030
pI
4.69
mw
14.11 kDa
protein length
130 aa Sequence Blast
gene length
393 bp Sequence Blast
function
fatty acid biosynthesis
product
-hydroxyacyl-ACP dehydratase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.2|Biosynthesis of lipids] → [category|SW 2.4.2.1|Biosynthesis of fatty acids]
  • Gene

    Coordinates
    455,346 455,738

    The protein

    Protein family

  • FabZ subfamily (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|BDA23FA513C240B07DC109BB62A7A5EB96B20965|YwpB]
  • Structure

  • [PDB|4I83]((3r)-hydroxymyristoyl-ACP dehydratase from Neisseria meningitidis, 34% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|65506215AE58BF53C57599E566E4F78514DB45AA|ycsD]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C021 (ycsD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2019 NBRP B. subtilis, Japan]
  • BKE04030 ([gene|65506215AE58BF53C57599E566E4F78514DB45AA|ycsD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE04030 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTATATCTCCTTTTTT, downstream forward: _UP4_TGAAAAAAACCCTTCACAAC
  • BKK04030 ([gene|65506215AE58BF53C57599E566E4F78514DB45AA|ycsD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK04030 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTATATCTCCTTTTTT, downstream forward: _UP4_TGAAAAAAACCCTTCACAAC
  • References

  • 17919287