SubtiBank SubtiBank
yqkD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yqkD

similar to esterase
locus
BSU_23640
pI
7.01
mw
34.49 kDa
protein length
305 aa Sequence Blast
gene length
918 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    2,460,664 2,461,581

    The protein

    Structure

  • [PDB|5G59] (from Pyrococcus furiosus, 29% identity) [pubmed|29307486]
  • Expression and Regulation

    Operons

    genes
    [gene|654EC5AFF767127FA3BA20A7B1ECDB93333AADDE|yqkD]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C409 (yqkD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2407 NBRP B. subtilis, Japan]
  • BKE23640 ([gene|654EC5AFF767127FA3BA20A7B1ECDB93333AADDE|yqkD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE23640 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAAGTCACAGCACCTTTC, downstream forward: _UP4_TAAAAAAGCGAAAGGCCTCT
  • BKK23640 ([gene|654EC5AFF767127FA3BA20A7B1ECDB93333AADDE|yqkD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK23640 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAAGTCACAGCACCTTTC, downstream forward: _UP4_TAAAAAAGCGAAAGGCCTCT
  • References

    Research papers

  • 29307486