SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


similar to esterase
34.49 kDa
protein length
305 aa Sequence Blast
gene length
918 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    2,460,664 2,461,581

    The protein


  • [PDB|5G59] (from Pyrococcus furiosus, 29% identity) [pubmed|29307486]
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-C409 (yqkD::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE23640 ([gene|654EC5AFF767127FA3BA20A7B1ECDB93333AADDE|yqkD]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAAGTCACAGCACCTTTC, downstream forward: _UP4_TAAAAAAGCGAAAGGCCTCT
  • BKK23640 ([gene|654EC5AFF767127FA3BA20A7B1ECDB93333AADDE|yqkD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAAGTCACAGCACCTTTC, downstream forward: _UP4_TAAAAAAGCGAAAGGCCTCT
  • References

    Research papers

  • 29307486