SubtiBank SubtiBank
ytmP
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ytmP

similar to choline kinase
locus
BSU_29920
pI
5.81
mw
30.64 kDa
protein length
204 aa Sequence Blast
gene length
615 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    3,060,674 3,061,288

    The protein

    Protein family

  • aminoglycoside phosphotransferase family (with [protein|349C99C258331962455100E2662DA2272E946C8A|YcbJ], according to UniProt)
  • Structure

  • [PDB|4R77] (from Streptococcus pneumoniae, 27% identity) [pubmed|25781969]
  • Expression and Regulation

    Operons

    genes
    [gene|651F41AA16B0BB59A613D74302F441BF6D5BFF64|ytmP]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A434 (ytmP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/434 NBRP B. subtilis, Japan]
  • BKE29920 ([gene|651F41AA16B0BB59A613D74302F441BF6D5BFF64|ytmP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE29920 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCGTTTTGTCCAAACCA, downstream forward: _UP4_CTCATGAAACGAATTGTTGA
  • BKK29920 ([gene|651F41AA16B0BB59A613D74302F441BF6D5BFF64|ytmP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK29920 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCGTTTTGTCCAAACCA, downstream forward: _UP4_CTCATGAAACGAATTGTTGA
  • References

    Research papers

  • 25781969