SubtiBank SubtiBank


pyridoxal-5-phosphate synthase (synthase domain)
31.46 kDa
protein length
294 aa Sequence Blast
gene length
885 bp Sequence Blast
pyridoxal-5-phosphate biosynthesis
pyridoxal-5-phosphate synthase (synthase domain)

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW|Biosynthesis of pyridoxal phosphate]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.9|Newly identified competence genes]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.8|Phosphorylation on either a Ser, Thr or Tyr residue]
  • Gene

    19,062 19,946

    Phenotypes of a mutant

  • auxotrophic for pyridoxal 5'-phosphate [Pubmed|14762015]
  • inactivation of ''[gene|651D1E534490276B9BE7BFE7B5819176AE09891E|pdxS]'' reduces sporulation efficiency to 1.2% that of wild type cells [Pubmed|26735940]
  • poor growth [pubmed|28189581]
  • non-transformable [pubmed|28189581]
  • The protein

    Catalyzed reaction/ biological activity

  • Catalyzes the formation of pyridoxal 5'-phosphate from ribose 5-phosphate (RBP), glyceraldehyde 3-phosphate (G3P) and ammonia. The ammonia is provided by the [protein|6F96C10759C1C20B3A6B396E3718F0A9281F100A|PdxT] subunit. (according to UniProt)
  • aldehydo-D-ribose 5-phosphate + D-glyceraldehyde 3-phosphate + L-glutamine --> H+ + 3 H2O + L-glutamate + phosphate + pyridoxal 5'-phosphate (according to UniProt)
  • Protein family

  • PdxS/SNZ family (single member, according to UniProt)
  • Modification

  • phosphorylated on Arg-8 [Pubmed|22517742]
  • phosphorylated on STY [Pubmed|16493705], [Pubmed|17726680]
  • Structure

  • [PDB|2NV2] [protein|651D1E534490276B9BE7BFE7B5819176AE09891E|PdxS]-[protein|6F96C10759C1C20B3A6B396E3718F0A9281F100A|PdxT] complex [Pubmed|17159152]
  • [PDB|2NV1] [protein|651D1E534490276B9BE7BFE7B5819176AE09891E|PdxS] [Pubmed|17159152]
  • additional information

  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation




  • the leader mRNA is processed upstream of [gene|7C3081BC8D416127A881627EB56C0628359111CF|dacA] by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y], this requires the [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|YmcA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|YlbF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|YaaT] complex [Pubmed|29794222]
  • Additional information

  • [protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP]∼P binds to the promoter region, but regulation has not been explored [pubmed|25666134]
  • view in new tab


    regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: repression, [Pubmed|14651647], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • regulation

  • negatively controlled by [SW|Spo0A] [Pubmed|14651647]
  • view in new tab

    view in new tab

    Biological materials


  • BKE00110 ([gene|651D1E534490276B9BE7BFE7B5819176AE09891E|pdxS]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCTTGGTCCCCCTAAT, downstream forward: _UP4_TAAGAACATAGGAGCGCTGC
  • BKK00110 ([gene|651D1E534490276B9BE7BFE7B5819176AE09891E|pdxS]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCTTGGTCCCCCTAAT, downstream forward: _UP4_TAAGAACATAGGAGCGCTGC
  • BV604 (([gene|651D1E534490276B9BE7BFE7B5819176AE09891E|pdxS]-[gene|6F96C10759C1C20B3A6B396E3718F0A9281F100A|pdxT])::tet), available in [SW|Fabian Commichau]'s lab, [Pubmed|24972371]
  • References

  • 15911615,14762015,25473090,14651647,17726680,16493705,16030023,19152323,17159152,22517742,15378759,25568319,26490441,16233205,28189581