SubtiBank SubtiBank
yfjL
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yfjL

similar to ribosomal protein L6
locus
BSU_08050
pI
8.03
mw
25.20 kDa
protein length
229 aa Sequence Blast
gene length
690 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms
yztA

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.5|Ribosomal protein/ based on similarity]
  • Gene

    Coordinates
    878,081 878,770

    Expression and Regulation

    Operons

    genes
    [gene|AF019A5EBB9A09326D3D19EB3AFB6D0B808950D2|yfjM]-[gene|65115BE5459B65B63094A3502EC11531675AD6BB|yfjL]
    description
    [pubmed|22383849]

    regulation

  • expression during spore [SW|germination] is strongly reduced under conditions of osmotic stress [Pubmed|27766092]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C279 (yfjL::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2277 NBRP B. subtilis, Japan]
  • BKE08050 ([gene|65115BE5459B65B63094A3502EC11531675AD6BB|yfjL]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE08050 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTCCCACTCTTTTCCT, downstream forward: _UP4_TAAAAAGATTTCCAAGGAAA
  • BKK08050 ([gene|65115BE5459B65B63094A3502EC11531675AD6BB|yfjL]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK08050 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTCCCACTCTTTTCCT, downstream forward: _UP4_TAAAAAGATTTCCAAGGAAA
  • References

  • 27766092