SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


similar to ribosomal protein L6
25.20 kDa
protein length
229 aa Sequence Blast
gene length
690 bp Sequence Blast

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW|Ribosomal protein/ based on similarity]
  • Gene

    878,081 878,770

    Expression and Regulation




  • expression during spore [SW|germination] is strongly reduced under conditions of osmotic stress [Pubmed|27766092]
  • view in new tab

    Biological materials


  • MGNA-C279 (yfjL::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE08050 ([gene|65115BE5459B65B63094A3502EC11531675AD6BB|yfjL]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTCCCACTCTTTTCCT, downstream forward: _UP4_TAAAAAGATTTCCAAGGAAA
  • BKK08050 ([gene|65115BE5459B65B63094A3502EC11531675AD6BB|yfjL]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTCCCACTCTTTTCCT, downstream forward: _UP4_TAAAAAGATTTCCAAGGAAA
  • References

  • 27766092