SubtiBank SubtiBank
ywbB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ywbB

unknown
locus
BSU_38380
pI
4.33
mw
25.71 kDa
protein length
225 aa Sequence Blast
gene length
678 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms
ipa-17d

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • Gene

    Coordinates
    3,937,553 3,938,230

    Expression and Regulation

    Operons

    genes
    [gene|64E4F910148F9349FA68FC685310D14C0A72BE8B|ywbB]
    description
    [Pubmed|9353933]
    view in new tab

    genes
    [gene|0650C9EAB395EB6ABDADBE72F0DA9F8E5E606B0E|ywbA]-[gene|64E4F910148F9349FA68FC685310D14C0A72BE8B|ywbB]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B220 (ywbB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1219 NBRP B. subtilis, Japan]
  • BKE38380 ([gene|64E4F910148F9349FA68FC685310D14C0A72BE8B|ywbB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE38380 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCGCACCTCCTTTACAT, downstream forward: _UP4_TAAAAAAGAACGTACATCAC
  • BKK38380 ([gene|64E4F910148F9349FA68FC685310D14C0A72BE8B|ywbB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK38380 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCGCACCTCCTTTACAT, downstream forward: _UP4_TAAAAAAGAACGTACATCAC
  • References

  • 9353933