pnpA

polynucleotide phosphorylase, RNase, involved in double-strand break repair

Locus: BSU_16690

Isoelectric point: 4.89

Molecular weight: 77.28 kDa

Protein length: 705 aa

Gene length: 2118 bp

Function: DNA repair, competence development, RNA degradation

Product: polynucleotide phosphorylase (PNPase)

Essential: no

E.C.: 2.7.7.8

Synonyms: comR

Genomic Context

Loading

Categories containing this gene/protein

• Information processing → Genetics → DNA repair/ recombination
• Information processing → Genetics → DNA repair/ recombination → Other proteins
• Information processing → Genetics → Genetic competence
• Information processing → RNA synthesis and degradation → RNases → Exoribonucleases
• Lifestyles → Exponential and early post-exponential lifestyles → Genetic competence

Gene

Coordinates: 1,739,383 1,741,500

Phenotypes of a mutant

• The pnpA mutant is cold sensitive and sensitive to tetracyclin, it shows multiseptate filamentous growth PubMed
• The mutant is deficient in genetic competence (no expression of the late competence genes) PubMed
• The pnpA mutant exhibits reduced motility and reduced expression of the fla-che operon resulting from accumulation of slrA mRNA PubMed
• The mutant overexpresses the trp and putB-putC-putP operons.

The protein

Catalyzed reaction/ biological activity

• 3'-5' exoribonuclease, RNase
• PNPase degrades the trp mRNA from RNA-TRAP complex
• degradation of the SlrA mRNA from the 3' end, through the Rho-dependent terminator PubMed
• involved in double-strand break (DSB) repair via homologous recombination (HR) or non-homologous end-joining (NHEJ) PubMed
• degrades ssDNA (3' - 5') (stimulated by RecA, inhibited by SsbA) PubMed
• can polymerize ssDNA at a free 3' OH end, stimulated by RecN PubMed
• phosphate + RNA_(n+1) --> ribonucleoside 5'-diphosphate + RNA_(n) (according to UniProt)

Protein family

• polyribonucleotide nucleotidyltransferase family (single member, according to UniProt)

Domains

• KH domain (aa 554-613) (according to UniProt)
• S1 domain (aa 623-691) (according to UniProt)

Structure

• 5YJJ (protein from Staphylococcus aureus) PubMed
• 3GCM (protein from E. coli, PNPase/RNase E micro-domain/RNA tetragonal crystal form )

Localization

• cytoplasm (homogeneous) PubMed

Additional information

• required for the expression of late competence genes comGA and comK, requirement bypassed by a mecA disruption; may be necessary for modification of the srfAA transcript (stabilization or translation activation)
• belongs to the 100 most abundant proteins PubMed

Expression and Regulation

Operons

• Genes: pnpA
  Description: PubMed

  Regulatory mechanism

  • stringent response: negative regulation, in stringent response

  Regulation

  • RelA dependent downregulation (Class I) during stringent response PubMed

Biological materials

Mutant

• GP1748 (pnpA::aphA3), available in Jörg Stülke's lab, PubMed
• BKE16690 (pnpA::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATACAATTACGAACTCCTC, downstream forward: _UP4_TAAATGAAAACATAAAAGGA
• BKK16690 (pnpA::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATACAATTACGAACTCCTC, downstream forward: _UP4_TAAATGAAAACATAAAAGGA

Expression vectors

• for expression, purification in E. coli with N-terminal His-tag, in pWH844: pGP838, available in Jörg Stülke's lab
• for expression/ purification from B. subtilis with N-terminal Strep-tag, for SPINE, in pGP380: pGP1342, available in Jörg Stülke's lab
• for chromosomal expression of PnpA-Strep (cat): GP1002, available in Jörg Stülke's lab
• for chromosomal expression of PnpA-Strep (spc): GP1038, available in Jörg Stülke's lab
• pGP1439: IPTG inducible expression, purification in E. coli with N-terminal Strep-tag, in pGP172, available in Jörg Stülke's lab

GFP fusion

• GP1698 (in pBP43), expression of pnpA-GFP::spc under the native promoter, available in Jörg Stülke's lab PubMed

Two-hybrid system

• B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Jörg Stülke's lab, PubMed

FLAG-tag construct

• GP1021 (spc, based on pGP1331) PubMed, available in Jörg Stülke's lab
• GP1076 (ermC) PubMed, available in Jörg Stülke's lab

Labs working on this gene/protein

• David Bechhofer, Mount Sinai School, New York, USA Laboratories and Programs/Bechhofer Laboratory?citype=Physician&ciid=Bechhofer David H 1255565 Homepage

References

Reviews

Loading

Original publications

Loading

PNPase in ''E. coli

Loading