SubtiBank SubtiBank
pksB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

pksB

involved in polyketide synthesis
locus
BSU17090
pI
6.59
mw
25.76 kDa
protein length
225 aa Sequence Blast
gene length
678 bp Sequence Blast
function
polyketide synthesis
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW 2.6.6.1|Biosynthesis of antibacterial compounds]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.15|Biosynthesis of antibacterial compounds]
  • Gene

    Coordinates
    1,782,713 1,783,390

    The protein

    Protein family

  • [SW|metallo-beta-lactamase superfamily] (according to UniProt)
  • Structure

  • [PDB|4YSB] (from Myxococcus xanthus, 28% identity) [pubmed|26082492]
  • Expression and Regulation

    Operons

    genes
    [gene|647B1D7E496E81E7FC7FD2BDCACC2486852BAC19|pksB]-[gene|55C821F68B2E5F9F45CC2B2C9494D48D5C33266A|pksC]-[gene|F3E9CA9330394FD829D59B0C2D4D1EEDD2C22D3B|pksD]-[gene|CB0B856B22984DD5B10F01DD07C3961FAA742923|pksE]-[gene|6BEC9E2BCECE33803EAC14DE7E8E988FC9C8DC8B|acpK]-[gene|85D6E439529E8B3F73244A0B004B394B4FE65509|pksF]-[gene|F4C96980640CB04D3017B8EBB02918006CBCF7BB|pksG]-[gene|A4CF68F602273CFDFD55EFD2C1164F0E2E8F6972|pksH]-[gene|F437A90A97CF8ED4BA1E5CCA8A33D9E93612902B|pksI]-[gene|13EB6B903088C11D985DDB7CEC864797058FE038|pksJ]-[gene|BABBC5848F9BBF9E9318252F5AD7D1C4F55FCEAB|pksL]-[gene|40779D3A6E4F72EEFD702BF9FA15B57951783D12|pksM]-[gene|66AFF1FC7D1BBA8EA5BB57A935FF5AB890A895C1|pksN]-[gene|85213235F7D3D8E711963E53F314ED758B5FA94B|pksR]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE17090 ([gene|647B1D7E496E81E7FC7FD2BDCACC2486852BAC19|pksB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE17090 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTATACCATCCCTATCA, downstream forward: _UP4_TAATCCTTCTGAATCTATTA
  • BKK17090 ([gene|647B1D7E496E81E7FC7FD2BDCACC2486852BAC19|pksB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK17090 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTATACCATCCCTATCA, downstream forward: _UP4_TAATCCTTCTGAATCTATTA
  • References

    Research papers

  • 26082492