SubtiBank SubtiBank
pksB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

pksB

involved in polyketide synthesis
locus
BSU_17090
pI
6.59
mw
25.76 kDa
protein length
225 aa Sequence Blast
gene length
678 bp Sequence Blast
function
polyketide synthesis
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW 2.6.6.1|Biosynthesis of antibacterial compounds]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.15|Biosynthesis of antibacterial compounds]
  • Gene

    Coordinates
    1,782,713 1,783,390

    The protein

    Protein family

  • [SW|metallo-beta-lactamase superfamily] (according to UniProt)
  • Structure

  • [PDB|4YSB] (from Myxococcus xanthus, 28% identity) [pubmed|26082492]
  • Expression and Regulation

    Operons

    genes
    [gene|647B1D7E496E81E7FC7FD2BDCACC2486852BAC19|pksB]-[gene|55C821F68B2E5F9F45CC2B2C9494D48D5C33266A|pksC]-[gene|F3E9CA9330394FD829D59B0C2D4D1EEDD2C22D3B|pksD]-[gene|CB0B856B22984DD5B10F01DD07C3961FAA742923|pksE]-[gene|6BEC9E2BCECE33803EAC14DE7E8E988FC9C8DC8B|acpK]-[gene|85D6E439529E8B3F73244A0B004B394B4FE65509|pksF]-[gene|F4C96980640CB04D3017B8EBB02918006CBCF7BB|pksG]-[gene|A4CF68F602273CFDFD55EFD2C1164F0E2E8F6972|pksH]-[gene|F437A90A97CF8ED4BA1E5CCA8A33D9E93612902B|pksI]-[gene|13EB6B903088C11D985DDB7CEC864797058FE038|pksJ]-[gene|BABBC5848F9BBF9E9318252F5AD7D1C4F55FCEAB|pksL]-[gene|40779D3A6E4F72EEFD702BF9FA15B57951783D12|pksM]-[gene|66AFF1FC7D1BBA8EA5BB57A935FF5AB890A895C1|pksN]-[gene|85213235F7D3D8E711963E53F314ED758B5FA94B|pksR]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE17090 ([gene|647B1D7E496E81E7FC7FD2BDCACC2486852BAC19|pksB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE17090 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTATACCATCCCTATCA, downstream forward: _UP4_TAATCCTTCTGAATCTATTA
  • BKK17090 ([gene|647B1D7E496E81E7FC7FD2BDCACC2486852BAC19|pksB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK17090 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTATACCATCCCTATCA, downstream forward: _UP4_TAATCCTTCTGAATCTATTA
  • References

    Research papers

  • 26082492