SubtiBank SubtiBank
ypzA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ypzA

unknown
locus
BSU_21950
pI
4.05
mw
9.92 kDa
protein length
gene length
270 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • Gene

    Coordinates
    2,308,495 2,308,764

    Expression and Regulation

    Operons

    genes
    [gene|6452C3EE9644BD462E675DEE95D1683D47EEF4A4|ypzA]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|15699190,16497325], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulation

  • expressed late during sporulation in the forespore ([protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]) [Pubmed|15699190,16497325]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A873 (ypzA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/873 NBRP B. subtilis, Japan]
  • BKE21950 ([gene|6452C3EE9644BD462E675DEE95D1683D47EEF4A4|ypzA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE21950 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAAAAAACACCTCCGCCA, downstream forward: _UP4_TAAAAACCGCAGCTTCTGCG
  • BKK21950 ([gene|6452C3EE9644BD462E675DEE95D1683D47EEF4A4|ypzA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK21950 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAAAAAACACCTCCGCCA, downstream forward: _UP4_TAAAAACCGCAGCTTCTGCG
  • References

  • 15699190,16497325