SubtiBank SubtiBank
yutG [2018-02-12T14:11:56.000Z]

yutG [2018-02-12T14:11:56.000Z]

similar to low temperature requirement C protein
locus
BSU32280
pI
4.99
mw
18.52 kDa
protein length
166 aa Sequence Blast
gene length
498 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • Gene

    Coordinates
    3,317,502 → 3,318,002

    The protein

    Paralogous protein(s)

  • [protein|2CB3BAF17F59A858D249619A436EF660CAA58DD5|YpjQ]
  • Structure

  • [PDB|1RFZ] (Geobacillus stearothermophilus)
  • Expression and Regulation

    Operons

    genes
    [gene|644638C7B9CA839714E086AF604BD7D2853C7E95|yutG]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A973 (yutG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/973 NBRP B. subtilis, Japan]
  • BKE32280 (Δ[gene|644638C7B9CA839714E086AF604BD7D2853C7E95|yutG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE32280 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAGCTTCACCCAATCTT, downstream forward: _UP4_TAAGGGCACCCTTTTAGGGC
  • BKK32280 (Δ[gene|644638C7B9CA839714E086AF604BD7D2853C7E95|yutG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK32280 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAGCTTCACCCAATCTT, downstream forward: _UP4_TAAGGGCACCCTTTTAGGGC