SubtiBank SubtiBank


similar to low temperature requirement C protein
18.52 kDa
protein length
166 aa Sequence Blast
gene length
501 bp Sequence Blast

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Newly identified sporulation proteins (based on transcription profiling)]
  • Gene

    3,317,502 3,318,002

    The protein

    Paralogous protein(s)

  • [protein|2CB3BAF17F59A858D249619A436EF660CAA58DD5|YpjQ]
  • Structure

  • [PDB|1RFZ] (Geobacillus stearothermophilus)
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-A973 (yutG::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE32280 ([gene|644638C7B9CA839714E086AF604BD7D2853C7E95|yutG]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAGCTTCACCCAATCTT, downstream forward: _UP4_TAAGGGCACCCTTTTAGGGC
  • BKK32280 ([gene|644638C7B9CA839714E086AF604BD7D2853C7E95|yutG]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAGCTTCACCCAATCTT, downstream forward: _UP4_TAAGGGCACCCTTTTAGGGC