SubtiBank SubtiBank
yojF
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yojF

unknown
locus
BSU19470
pI
7.32
mw
12.90 kDa
protein length
116 aa Sequence Blast
gene length
351 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    2,122,325 2,122,675

    The protein

    Structure

  • [PDB|1NJH]
  • Expression and Regulation

    Operons

    genes
    [gene|7922A49FBC7CCDC8C585EF6E67D7CC9CC91059F7|yoyC]-[gene|63EC848DB7CC4464B070E65D2C9288851B08BBE3|yojF]-[gene|8106404D9D2CFA0825E1284D47CC7198D8A20E5D|bshB2]
    description
    (major transcript) [Pubmed|23894131,20308541]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|23894131], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx]: activation, [Pubmed|23894131], in [regulon|2C6386E9A63F410558D168798D077DF91590F454|Spx regulon]
  • regulation

  • ''[protein|search|yoyC]'': induced by diamide stess (thiol depletion) ([protein|search|Spx]) [Pubmed|23894131]
  • view in new tab

    genes
    [gene|FBF1A8C92149A216D8A46F9E02898D7C5C448E2A|yojE]-[gene|7922A49FBC7CCDC8C585EF6E67D7CC9CC91059F7|yoyC]-[gene|63EC848DB7CC4464B070E65D2C9288851B08BBE3|yojF]-[gene|8106404D9D2CFA0825E1284D47CC7198D8A20E5D|bshB2]
    description
    [Pubmed|23894131]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|23894131], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulation

  • ''[protein|search|yoyC]'': induced by diamide stess (thiol depletion) ([protein|search|Spx]) [Pubmed|23894131]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B429 (yojF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1428 NBRP B. subtilis, Japan]
  • CS211 (''[gene|63EC848DB7CC4464B070E65D2C9288851B08BBE3|yojF]''::''aphA3'', available in [SW|Colin Harwood]'s and [SW|Jörg Stülke]'s labs) [Pubmed|27197833]
  • BKE19470 ([gene|63EC848DB7CC4464B070E65D2C9288851B08BBE3|yojF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19470 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTCATGATTGCTCCCCTCT, downstream forward: _UP4_GTTTAAAGAAAAGGGTGAAT
  • BKK19470 ([gene|63EC848DB7CC4464B070E65D2C9288851B08BBE3|yojF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19470 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTCATGATTGCTCCCCTCT, downstream forward: _UP4_GTTTAAAGAAAAGGGTGAAT
  • References

    Operon and expression

  • 20308541,23894131,27197833