SubtiBank SubtiBank
ywzF
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ywzF

unknown, putative pseudogene
locus
BSU_36669
pI
0.00
mw
0.00 kDa
protein length
gene length
183 bp Sequence Blast
function
unknown
product
unknown
essential
-
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    3,769,626 3,769,808

    Expression and Regulation

    Operons

    genes
    [gene|63CF8C8BBCE39BD585DD5F6C8BBD95E12B500AE6|ywzF]-[gene|1D9596609AEF10456041918BD592E49466D93B1F|ywzE]-[gene|57B6D70B2570C308377B301EC2AF6C232233FD46|ureA]-[gene|B1559A1482B1F5932E6F77B32BF87E7474E01C17|ureB]-[gene|CD3DD65D6EFF11564088CA8D56640F772DEAC2D9|ureC]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE36669 ([gene|63CF8C8BBCE39BD585DD5F6C8BBD95E12B500AE6|ywzF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE36669 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTGAATCCCCGCTTGTGT, downstream forward: _UP4_TAACGTCTGGTTATGATCAA
  • BKK36669 ([gene|63CF8C8BBCE39BD585DD5F6C8BBD95E12B500AE6|ywzF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK36669 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTGAATCCCCGCTTGTGT, downstream forward: _UP4_TAACGTCTGGTTATGATCAA