SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


unknown, putative pseudogene
0.00 kDa
protein length
gene length
183 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    3,769,626 3,769,808

    Expression and Regulation


    view in new tab

    Biological materials


  • BKE36669 ([gene|63CF8C8BBCE39BD585DD5F6C8BBD95E12B500AE6|ywzF]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTGAATCCCCGCTTGTGT, downstream forward: _UP4_TAACGTCTGGTTATGATCAA
  • BKK36669 ([gene|63CF8C8BBCE39BD585DD5F6C8BBD95E12B500AE6|ywzF]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTGAATCCCCGCTTGTGT, downstream forward: _UP4_TAACGTCTGGTTATGATCAA