SubtiBank SubtiBank
proG
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

proG

1-pyrroline-5-carboxylate dehydrogenase
locus
BSU_12910
pI
4.91
mw
30.05 kDa
protein length
272 aa Sequence Blast
gene length
819 bp Sequence Blast
function
biosynthesis of proline
product
1-pyrroline-5-carboxylate dehydrogenase
essential
no
ec
1.5.1.2
synonyms
ykeA,yzcA

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.2|Biosynthesis/ acquisition of proline]
  • Gene

    Coordinates
    1,359,454 1,360,272

    The protein

    Catalyzed reaction/ biological activity

  • 1-pyrroline-5-carboxylate + NADPH + H+ --> L-proline + NADP+ [pubmed|28824574]
  • L-proline + NADP+ --> 1-pyrroline-5-carboxylate + 2 H+ + NADPH (according to UniProt)
  • L-proline + NAD+ --> 1-pyrroline-5-carboxylate + 2 H+ + NADH (according to UniProt)
  • Protein family

  • [SW|pyrroline-5-carboxylate reductase family] [pubmed|28824574]
  • [SW|Cofactors]

  • NADPH [pubmed|28824574]
  • Effectors of protein activity

  • feedback-inhibited by proline [pubmed|28824574]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|63AFCEE5DEA6B2604C02592C5FB52EDFAE68913E|proG]
    description
    [Pubmed|1766370,21784929]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B308 (ykeA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1307 NBRP B. subtilis, Japan]
  • BKE12910 ([gene|63AFCEE5DEA6B2604C02592C5FB52EDFAE68913E|proG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE12910 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGACTCAGTCCTTTCAT, downstream forward: _UP4_TGAATCCTTGAAAGAGGATT
  • BKK12910 ([gene|63AFCEE5DEA6B2604C02592C5FB52EDFAE68913E|proG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK12910 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGACTCAGTCCTTTCAT, downstream forward: _UP4_TGAATCCTTGAAAGAGGATT
  • References

    Reviews

  • 25367752
  • Original publications

  • 11418582,1766370,21784929,28752945,28824574