SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


two-component response regulator ([SW|OmpR family]), regulation of phosphate metabolism
27.53 kDa
protein length
240 aa Sequence Blast
gene length
723 bp Sequence Blast
regulation of phosphate metabolism ([gene|E0430C16C41440633647976A0F9183E24268E198|phoA], [gene|3B95AB3021280215B6B487A348D78FB5797AEEA6|phoB], [gene|597771E2E8EC31ED9B2CC8C0E4D888DEEA80F689|phoD], [gene|F7D869F77E2275110737EF658C58FA1BF742D73F|resABCDE], [gene|72A89412C53703F96F835D26307263F5D1A4AB4E|tagA]-[gene|911A4D957A6C0DFC636A152395119DBFC777DDA2|tagB], [gene|8620DA76A1953D7ACDFA7E46ED81EF1A0D97999C|tagDEF], [[gene|tuaA|tuaA-H]])
two-component response regulator ([SW|OmpR family])

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.3|Phosphate metabolism]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Two-component system response regulators]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.5|Regulators of core metabolism]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Sporulation proteins/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.2|Phosphorylation on an Asp residue]
  • Gene

    2,977,800 2,978,522

    The protein

    Protein family

  • [SW|OmpR family] of two-component response regulators
  • Paralogous protein(s)

  • [protein|6A37531896205A9B894C81AB0563C216C0B52CD7|YkoG], [protein|706983E6942E883D3A9D45693E7B4015AEABE60B|YclJ], [protein|7F340423A34CE40D1F1AA8D373F7C4B859A6496D|WalR]
  • [SW|Domains]

  • [SW|Response regulatory domain] (aa 4-118) (according to UniProt)
  • Modification

  • phosphorylation by [protein|C81F68521F17861D50926D7D8757DC1D2340BC0D|PhoR] under conditions of phosphate limitation (stimulates DNA-binding activity)
  • Effectors of protein activity

  • phosphorylation stimulates DNA-binding activity
  • Structure

  • [PDB|2OQR] (from Mycobacterium tuberculosis, 44% identity) [pubmed|17942407]
  • [PDB|1MVO] (receiver domain)
  • [SW|Localization]

  • cytoplasm (according to UniProt)
  • additional information

  • information on binding sites can be found in the [ PRODORIC2 database]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|16452408], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|15205429], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190,15205429], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|16452408,12850135], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC]: repression, [Pubmed|20382764], in [regulon|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC regulon]
  • [protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP]: activation, due to [protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP]~P binding to the 3’end of the [protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP]-[protein|C81F68521F17861D50926D7D8757DC1D2340BC0D|PhoR] operon [Pubmed|25666134,15205429,14762014], in [regulon|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP regulon]
  • regulation

  • carbon catabolite repression ([protein|search|CcpA]) [Pubmed|16452408,12850135]
  • view in new tab

    Biological materials


  • 1A966 ( ''phoP''::''tet''), [Pubmed|14973033], available at [ BGSC]
  • BKE29110 ([gene|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|phoP]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTGTGCCTCCAGTATT, downstream forward: _UP4_TATAAACTGGAGGAGCCAAA
  • BKK29110 ([gene|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|phoP]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTGTGCCTCCAGTATT, downstream forward: _UP4_TATAAACTGGAGGAGCCAAA
  • labs

  • [SW|Marion Hulett], University of Illinois at Chicago, USA [ Homepage]
  • References


  • 30459743
  • Regulation of [gene|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|phoP]-[gene|C81F68521F17861D50926D7D8757DC1D2340BC0D|phoR] expression

  • 20382764,14762014,12850135,15205429,16452408,25666134
  • Biochemical analyses

  • 9680208,9611818,12486063,20167622,10433720,17085571,14973033,12486062,17942407
  • Targets of PhoR

  • 20059685 16030210, 10913081,10094677,9683503,9988472,9457886,9335276,9593301,9098050,21636651
  • Other original publications

  • 10094672,15576792