SubtiBank SubtiBank
sigO
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

sigO

[SW|RNA polymerase] [SW|sigma factor] SigO (with [protein|AE8D4F07EFB17DA727D80229C3E72075928AA352|RsoA])
locus
BSU_33230
pI
9.78
mw
22.54 kDa
protein length
177 aa Sequence Blast
gene length
531 bp Sequence Blast
function
[SW|RNA polymerase] [SW|sigma factor]
product
co-sigma factor with [protein|AE8D4F07EFB17DA727D80229C3E72075928AA352|RsoA]
essential
no
synonyms
yvrI

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.2|RNA synthesis and degradation] → [category|SW 3.2.1|Transcription] → [category|SW 3.2.1.2|Sigma factors]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW 3.4.1.1|Sigma factors]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.3|Acid stress proteins (controlled by YvrI-YvrHa)]
  • Gene

    Coordinates
    3,409,462 → 3,409,992

    The protein

    Protein family

  • [SW|Sigma-70 factor family] (according to UniProt)
  • [SW|Domains]

  • contains a DNA-binding helix-turn-helix motif (HTH) and the region 4.2 of Sigma factors [Pubmed|19940246]
  • Expression and Regulation

    Operons

    genes
    [gene|6359025A73C0BD313F5BCC6F56FE88B820902AAA|sigO]-[gene|AE8D4F07EFB17DA727D80229C3E72075928AA352|rsoA]
    description
    [Pubmed|19047353]

    sigma factors

  • [protein|6359025A73C0BD313F5BCC6F56FE88B820902AAA|SigO]: sigma factor, [Pubmed|19047353], in [regulon|6359025A73C0BD313F5BCC6F56FE88B820902AAA|SigO regulon]
  • [protein|AE8D4F07EFB17DA727D80229C3E72075928AA352|RsoA]: sigma factor, in [regulon|AE8D4F07EFB17DA727D80229C3E72075928AA352|RsoA regulon]
  • regulatory mechanism

  • [protein|7098319D8E88FDC2A629A3F4A21507FD7A649385|YvrHb]: activation, [Pubmed|16306698], in [regulon|7098319D8E88FDC2A629A3F4A21507FD7A649385|YvrHb regulon]
  • regulation

  • induced by acidic growth conditions [Pubmed|19047353]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B052 (yvrI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1051 NBRP B. subtilis, Japan]
  • BKE33230 (Δ[gene|6359025A73C0BD313F5BCC6F56FE88B820902AAA|sigO]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33230 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATGCTTCATTATCTCCTTAC, downstream forward: _UP4_CAAAAAAAGGGGGAAAAGTA
  • BKK33230 (Δ[gene|6359025A73C0BD313F5BCC6F56FE88B820902AAA|sigO]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33230 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATGCTTCATTATCTCCTTAC, downstream forward: _UP4_CAAAAAAAGGGGGAAAAGTA
  • labs

  • [SW|John Helmann], Cornell University, USA [http://www.micro.cornell.edu/research/labs/helmann-lab/index.cfm Homepage]
  • References

  • 18573182,19047353,26651345,16306698,19940246,26367498,26400263,27558998