SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


[protein|search|RNA polymerase] delta subunit, affects the regulation of [SW|RNA polymerase] by the concentration of the initiating nucleoside triphosphate (iNTP)
20.25 kDa
protein length
173 aa Sequence Blast
gene length
522 bp Sequence Blast
[SW|RNA polymerase] delta subunit

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.2|RNA synthesis and degradation] → [category|SW 3.2.1|Transcription] → [category|SW|RNA polymerase]
  • Gene

    3,812,542 3,813,063

    Phenotypes of a mutant

  • [protein|632C661255DD9C2865CB2F9D68A805997A833BCB|RpoE] is essential for cell survival when facing a competing strain in changing environment [Pubmed|23543716]
  • The protein

    Catalyzed reaction/ biological activity

  • binds to DNA immediately upstream of the promoter element at A-rich sequences on the abrB and rrnB1 promoters and facilitates open complex formation [Pubmed|26546673]
  • represses expression of ''[gene|29D91115BB3AC03538D618E54A5A57F92777EFF6|spo0B]'' [Pubmed|27679485]
  • Protein family

  • rpoE family (single member, according to UniProt)
  • [SW|Domains]

  • HARE-HTH domain (aa 15-81) (according to UniProt)
  • Structure

  • [PDB|2M4K] (full-length protein) [Pubmed|23868186]
  • [PDB|2KRC] (N-terminal domain) [Pubmed|20310067]
  • [SW|Localization]

  • closely associated with [SW|RNA polymerase] involved in transcribing both mRNA and rRNA operons [Pubmed|20724389]
  • Expression and Regulation




  • the mRNA is processed between [gene|632C661255DD9C2865CB2F9D68A805997A833BCB|rpoE] and [gene|CEE04B9FED63AFEAB912791402F7578E852005D1|pyrG] by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y], this requires the [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|YmcA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|YlbF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|YaaT] complex [Pubmed|29794222]
  • view in new tab


    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|17189250], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • view in new tab


    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|17189250], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|8A8F93BAD0582F712C9EE1C3FE6C04292E91F390|FadR]: repression, [Pubmed|17189250], in [regulon|8A8F93BAD0582F712C9EE1C3FE6C04292E91F390|FadR regulon]
  • regulation

  • repressed in the absence of long-chain fatty acids ([protein|8A8F93BAD0582F712C9EE1C3FE6C04292E91F390|FadR]) [Pubmed|17189250]
  • view in new tab

    additional information

  • present at equimolar levels with [SW|RNA polymerase] [PubMed|20724389]
  • Biological materials


  • BKE37160 ([gene|632C661255DD9C2865CB2F9D68A805997A833BCB|rpoE]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGGTCGGACACTCCCTTT, downstream forward: _UP4_TAGTATCAGATTTCATCTTC
  • BKK37160 ([gene|632C661255DD9C2865CB2F9D68A805997A833BCB|rpoE]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGGTCGGACACTCCCTTT, downstream forward: _UP4_TAGTATCAGATTTCATCTTC
  • LK1098 (([gene|632C661255DD9C2865CB2F9D68A805997A833BCB|rpoE]::aphA3), available in [SW|Libor Krasny]'s and [SW|Jörg Stülke]'s labs
  • labs

  • [SW|Arthur Aronson], Purdue University, West Lafayette, USA [ homepage]
  • References


  • 22210308,25878038
  • Original publications

  • 7545758,7599136,7515111,10336502,2843435,17189250,3097010,6788769,23543716,22350953,20890634,20724389,20310067,23868186,21424579,24520113,24937760,24491578,26546673,27679485,29794222