SubtiBank SubtiBank
ytkA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ytkA

unknown
locus
BSU_30660
pI
4.74
mw
15.71 kDa
protein length
145 aa Sequence Blast
gene length
438 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms
yznA

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    3,136,938 3,137,375

    Expression and Regulation

    Operons

    genes
    [gene|631CD7AD2059BD9A2F56BD7F169B245589465184|ytkA]-[gene|11D04B31B4BF223E276077EC16BBDA566694CBF6|dps]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A295 (ytkA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/295 NBRP B. subtilis, Japan]
  • BKE30660 ([gene|631CD7AD2059BD9A2F56BD7F169B245589465184|ytkA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE30660 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCCATCACCCTTTCATC, downstream forward: _UP4_TCAGAAGAGGAGCATTCACA
  • BKK30660 ([gene|631CD7AD2059BD9A2F56BD7F169B245589465184|ytkA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK30660 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCCATCACCCTTTCATC, downstream forward: _UP4_TCAGAAGAGGAGCATTCACA