SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


15.71 kDa
protein length
145 aa Sequence Blast
gene length
438 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    3,136,938 3,137,375

    Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-A295 (ytkA::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE30660 ([gene|631CD7AD2059BD9A2F56BD7F169B245589465184|ytkA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCCATCACCCTTTCATC, downstream forward: _UP4_TCAGAAGAGGAGCATTCACA
  • BKK30660 ([gene|631CD7AD2059BD9A2F56BD7F169B245589465184|ytkA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCCATCACCCTTTCATC, downstream forward: _UP4_TCAGAAGAGGAGCATTCACA