SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


involved in cell lysis upon induction of PBSX, required for the formation of membrane vesicles in a sub-population of cells
9.86 kDa
protein length
gene length
270 bp Sequence Blast
host cell lysis

Genomic Context



  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.1|PBSX prophage]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    1,346,731 1,347,000

    The protein


  • cell membrane (according to UniProt)
  • Expression and Regulation


    view in new tab


    sigma factors

  • [protein|458406A4E6824C24493CFC19718F10720AA3B453|Xpf]: sigma factor, [Pubmed|8083174], in [regulon|458406A4E6824C24493CFC19718F10720AA3B453|Xpf regulon]
  • regulation

  • expression during spore [SW|germination] is strongly reduced under conditions of osmotic stress [Pubmed|27766092]
  • view in new tab

    Biological materials


  • BKE12790 ([gene|630FC0D9BDD243D6BF94DBDE506EC2A9CB0AAFE6|xhlA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTCTCACTCCTCCTTCA, downstream forward: _UP4_CTGCAGCATTAAAGGGGGAT
  • BKK12790 ([gene|630FC0D9BDD243D6BF94DBDE506EC2A9CB0AAFE6|xhlA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTCTCACTCCTCCTTCA, downstream forward: _UP4_CTGCAGCATTAAAGGGGGAT
  • References

  • 9555893,7921239,21630458,28883390