SubtiBank SubtiBank
yclD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yclD

putative FMN-binding subunit of phenolic acid decarboxylase
locus
BSU_03652
pI
7.00
mw
18.00 kDa
protein length
154 aa Sequence Blast
gene length
465 bp Sequence Blast
function
resistance to salicylic acid
product
putative phenolic acid decarboxylase subunit
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.10|Resistance against other toxic compounds (nitric oxide, phenolic acids, flavonoids, oxalate)]
  • Gene

    Coordinates
    414,819 415,283

    The protein

    [SW|Cofactors]

  • FMN or FAD [Pubmed|21635694]
  • Biological materials

    Mutant

  • BKE03652 ([gene|62C0A9412BB86FE5B517163525FCB6A4B83AF580|yclD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03652 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTCTGACATACAGTTCACGC, downstream forward: _UP4_TAATATCGATAGCCTGACGC
  • BKK03652 ([gene|62C0A9412BB86FE5B517163525FCB6A4B83AF580|yclD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03652 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTCTGACATACAGTTCACGC, downstream forward: _UP4_TAATATCGATAGCCTGACGC
  • References

  • 15979273