SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


putative FMN-binding subunit of phenolic acid decarboxylase
18.00 kDa
protein length
154 aa Sequence Blast
gene length
465 bp Sequence Blast
resistance to salicylic acid
putative phenolic acid decarboxylase subunit

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.10|Resistance against other toxic compounds (nitric oxide, phenolic acids, flavonoids, oxalate)]
  • Gene

    414,819 415,283

    The protein


  • FMN or FAD [Pubmed|21635694]
  • Biological materials


  • BKE03652 ([gene|62C0A9412BB86FE5B517163525FCB6A4B83AF580|yclD]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTCTGACATACAGTTCACGC, downstream forward: _UP4_TAATATCGATAGCCTGACGC
  • BKK03652 ([gene|62C0A9412BB86FE5B517163525FCB6A4B83AF580|yclD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTCTGACATACAGTTCACGC, downstream forward: _UP4_TAATATCGATAGCCTGACGC
  • References

  • 15979273