SubtiBank SubtiBank
artQ
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

artQ

high affinity arginine [SW|ABC transporter] (permease)
locus
BSU23970
pI
9.08
mw
23.75 kDa
protein length
219 aa Sequence Blast
gene length
660 bp Sequence Blast
function
arginine uptake
product
high affinity arginine [SW|ABC transporter] (permease)
essential
no
synonyms
yqiY

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.1|Importers] → [category|SW 1.2.1.1.2|Uptake of amino acids]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.4|Biosynthesis/ acquisition of arginine]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,491,289 2,491,948

    The protein

    Protein family

  • [SW|Binding-protein-dependent transport system permease family] (according to UniProt)
  • HisMQ subfamily (with [protein|1872614A6F7DBF7231348AC3DAE4ED3295ACEB41|YckA], according to UniProt)
  • Structure

  • [PDB|4YMS] (from Caldanaerobacter subterraneus, 44% identity) [pubmed|25848002]
  • [SW|Localization]

  • cell membrane [Pubmed|18763711]
  • Expression and Regulation

    Operons

    genes
    [gene|8D9529D46E11D8B2826A98642706ADCBE1E3434A|artP]-[gene|62BD291B91DB0358754957D84A1F3636C247A697|artQ]-[gene|6882EF93EC82872B25C88104F62D6603D2514890|artR]
    description
    [Pubmed|12107147]

    regulatory mechanism

  • [protein|F4097349A563503468A2A14F062AEAC532C7917A|YlxR]: regulation, [pubmed|30355672], in [regulon|F4097349A563503468A2A14F062AEAC532C7917A|YlxR regulon]
  • regulation

  • repressed by casamino acids [Pubmed|12107147]
  • induced in the absence of [protein|F4097349A563503468A2A14F062AEAC532C7917A|YlxR] [pubmed|30355672]
  • view in new tab

    Biological materials

    Mutant

  • GP1689 Δ([gene|8D9529D46E11D8B2826A98642706ADCBE1E3434A|artP]-[gene|62BD291B91DB0358754957D84A1F3636C247A697|artQ]-[gene|6882EF93EC82872B25C88104F62D6603D2514890|artR])::''mls'', available in [SW|Jörg Stülke]'s lab
  • MGNA-C382 ([gene|62BD291B91DB0358754957D84A1F3636C247A697|artQ]::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2380 NBRP B. subtilis, Japan]
  • BKE23970 ([gene|62BD291B91DB0358754957D84A1F3636C247A697|artQ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE23970 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGCCTTTGTCTCCTTTT, downstream forward: _UP4_GCTGTAGAAAGGAAGCTGAA
  • BKK23970 ([gene|62BD291B91DB0358754957D84A1F3636C247A697|artQ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK23970 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGCCTTTGTCTCCTTTT, downstream forward: _UP4_GCTGTAGAAAGGAAGCTGAA
  • References

  • 10092453,12107147,18763711,11423008,25848002