SubtiBank SubtiBank
htpX
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

htpX

stress-responsive membrane protease
locus
BSU13490
pI
10.16
mw
32.71 kDa
protein length
298 aa Sequence Blast
gene length
897 bp Sequence Blast
function
quality control of membrane proteins
product
membrane protease
essential
no
synonyms
ykrL

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.7|Proteolysis] → [category|SW 3.3.7.4|Additional proteins involved in proteolysis]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,414,997 1,415,893

    Phenotypes of a mutant

  • increased sensitivity to membrane protein overproduction [Pubmed|22447908]
  • increased sensitivity to dissipation of the membrane potential by the addition of valinomycin [Pubmed|22447908]
  • The protein

    Protein family

  • Peptidase M48B family (with [protein|4B54FF77FD5B6E22D6EF3DBECD9B84C0B5A60E18|YhfN], according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|62B6875301B458F04E3F65717AD3A5925A9C4973|htpX]
    description
    [Pubmed|22383849]

    regulatory mechanism

  • [protein|7283CDE72293A68D0B35E0C028D22FABE7FB43C7|YkrK]: repression, [Pubmed|22447908], in [regulon|7283CDE72293A68D0B35E0C028D22FABE7FB43C7|YkrK regulon]
  • [protein|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok]: repression, [Pubmed|22447908], in [regulon|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok regulon]
  • regulation

  • expression is increased due to mutations in ''[protein|EA6790EF30D3DDB9670FE52DFD2C5083AB6A48E1|ResE]'', ''[protein|495721E4B8BF6FEC01E62E86339560F90776EED1|ResB]'', ''[protein|81429F7802CD4B1F7DFDB6C900D7DA5ECA6B9F3F|SdhC]'', and'' [protein|0E1FAF4B3A967CC3882B3DDB3CA2D01FD70A0F7E|SdhA]'' [Pubmed|22447908]
  • view in new tab

    additional information

  • the mRNA is cleaved by [protein|BAB297D18F94FFA67B8D12A684AB4D1BCDFB4981|RNase III] [PubMed|26883633]
  • Biological materials

    Mutant

  • MGNA-B316 (ykrL::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1315 NBRP B. subtilis, Japan]
  • BKE13490 ([gene|62B6875301B458F04E3F65717AD3A5925A9C4973|htpX]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13490 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACAACCTCCGTTATTT, downstream forward: _UP4_TAATACAAACACATTGTTCC
  • BKK13490 ([gene|62B6875301B458F04E3F65717AD3A5925A9C4973|htpX]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13490 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACAACCTCCGTTATTT, downstream forward: _UP4_TAATACAAACACATTGTTCC
  • References

  • 22447908,22624725,22383849,23042994,26883633