SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


stress-responsive membrane protease
32.71 kDa
protein length
298 aa Sequence Blast
gene length
897 bp Sequence Blast
quality control of membrane proteins
membrane protease

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.7|Proteolysis] → [category|SW|Additional proteins involved in proteolysis]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    1,414,997 1,415,893

    Phenotypes of a mutant

  • increased sensitivity to membrane protein overproduction [Pubmed|22447908]
  • increased sensitivity to dissipation of the membrane potential by the addition of valinomycin [Pubmed|22447908]
  • The protein

    Protein family

  • Peptidase M48B family (with [protein|4B54FF77FD5B6E22D6EF3DBECD9B84C0B5A60E18|YhfN], according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation



    regulatory mechanism

  • [protein|7283CDE72293A68D0B35E0C028D22FABE7FB43C7|YkrK]: repression, [Pubmed|22447908], in [regulon|7283CDE72293A68D0B35E0C028D22FABE7FB43C7|YkrK regulon]
  • [protein|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok]: repression, [Pubmed|22447908], in [regulon|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok regulon]
  • regulation

  • expression is increased due to mutations in ''[protein|EA6790EF30D3DDB9670FE52DFD2C5083AB6A48E1|ResE]'', ''[protein|495721E4B8BF6FEC01E62E86339560F90776EED1|ResB]'', ''[protein|81429F7802CD4B1F7DFDB6C900D7DA5ECA6B9F3F|SdhC]'', and'' [protein|0E1FAF4B3A967CC3882B3DDB3CA2D01FD70A0F7E|SdhA]'' [Pubmed|22447908]
  • view in new tab

    additional information

  • the mRNA is cleaved by [protein|BAB297D18F94FFA67B8D12A684AB4D1BCDFB4981|RNase III] [PubMed|26883633]
  • Biological materials


  • MGNA-B316 (ykrL::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE13490 ([gene|62B6875301B458F04E3F65717AD3A5925A9C4973|htpX]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACAACCTCCGTTATTT, downstream forward: _UP4_TAATACAAACACATTGTTCC
  • BKK13490 ([gene|62B6875301B458F04E3F65717AD3A5925A9C4973|htpX]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACAACCTCCGTTATTT, downstream forward: _UP4_TAATACAAACACATTGTTCC
  • References

  • 22447908,22624725,22383849,23042994,26883633