SubtiBank SubtiBank
pbuO
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

pbuO

similar to hypoxanthine/guanine permease [protein|41DDD3AAFE89D0F52AB5ABD08CEE30A1767FFD7A|PbuG]
locus
BSU29990
pI
7.48
mw
45.26 kDa
protein length
432 aa Sequence Blast
gene length
1299 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms
ytiP

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.6|Nucleotide/ nucleoside transporter]
  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW 2.5.2.2|Biosynthesis/ acquisition of purine nucleotides/ based on similarity]
  • Gene

    Coordinates
    3,068,908 3,070,206

    The protein

    Paralogous protein(s)

  • [protein|41DDD3AAFE89D0F52AB5ABD08CEE30A1767FFD7A|PbuG]
  • Expression and Regulation

    Operons

    genes
    [gene|62AC66725C55B9E5FBBEB4EC43A88F7081B74D5C|pbuO]
    description
    [Pubmed|9387221]

    regulatory mechanism

  • [protein|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|PurR]: repression, (molecular inducer: PRPP) [Pubmed|11591660,2536750], in [regulon|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|PurR regulon]
  • regulation

  • repressed in the presence of purine nucleotides ([protein|search|PurR]) [Pubmed|11591660,2536750]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A819 (ytiP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/819 NBRP B. subtilis, Japan]
  • BKE29990 ([gene|62AC66725C55B9E5FBBEB4EC43A88F7081B74D5C|pbuO]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE29990 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGTATCCTCCAATTACG, downstream forward: _UP4_TAAGGATAGACCAAAAAACC
  • BKK29990 ([gene|62AC66725C55B9E5FBBEB4EC43A88F7081B74D5C|pbuO]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK29990 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGTATCCTCCAATTACG, downstream forward: _UP4_TAAGGATAGACCAAAAAACC
  • References

  • 11591660,2536750,9387221