SubtiBank SubtiBank
tagU
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

tagU

phosphotransferase, attaches teichoic acid, teichuronic acid, or acidic capsular polysaccharide to cell wall peptidoglycan via phosphodiester linkage to N-acteylmuramic acid
locus
BSU_35650
pI
9.53
mw
34.43 kDa
protein length
306 aa Sequence Blast
gene length
921 bp Sequence Blast
function
transfer of anionic cell wall polymers from lipid-linked precursors to peptidoglycan
product
phosphotransferase, responsible for attachment of anionic polymers to peptidoglycan
essential
no
synonyms
lytR

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.1|Cell wall synthesis] → [category|SW 1.1.1.6|Export of anionic polymers and attachment to peptidoglycan]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,663,281 3,664,201

    Phenotypes of a mutant

  • a ''[gene|62A3CC548E033A45F94FE4386EE29711A6A14C6B|tagU]'' mutant has no phenoype, the triple ''[gene|68FE85BAA457199D34C9068F38756972CD2D280D|tagT] [gene|62A3CC548E033A45F94FE4386EE29711A6A14C6B|tagU] [gene|E244A5ABB2FBD4FC3880F0DB700BD935991AE6DD|tagV]'' mutant is unable to grow under normal conditions [Pubmed|21964069]
  • The protein

    Protein family

  • LytR/CpsA/Psr (LCP) family (with [protein|E244A5ABB2FBD4FC3880F0DB700BD935991AE6DD|TagV] and [protein|68FE85BAA457199D34C9068F38756972CD2D280D|TagT], according to UniProt) [Pubmed|19099556]
  • Paralogous protein(s)

  • [protein|68FE85BAA457199D34C9068F38756972CD2D280D|TagT], [protein|E244A5ABB2FBD4FC3880F0DB700BD935991AE6DD|TagV]
  • [SW|Cofactors]

  • Mg2+ [Pubmed|29107701,21964069]
  • Structure

  • [PDB|6UF6] (aa 62-306) [pubmed|31969390]
  • [PDB|3MEJ] ([protein|68FE85BAA457199D34C9068F38756972CD2D280D|TagT], 36% identity, 69% similarity)
  • [SW|Localization]

  • cytoplasmic membrane (with extracytoplasmic catalaytic domain) [Pubmed|21964069]
  • Expression and Regulation

    Operons

    genes
    [gene|62A3CC548E033A45F94FE4386EE29711A6A14C6B|tagU]
    description
    [Pubmed|1357079]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1357079,9636707], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|19047346], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • [protein|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX]: sigma factor, [Pubmed|1357079,9636707], in [regulon|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX regulon]
  • regulatory mechanism

  • [protein|62A3CC548E033A45F94FE4386EE29711A6A14C6B|TagU]: auto-repression, [Pubmed|1357079], in [regulon|62A3CC548E033A45F94FE4386EE29711A6A14C6B|TagU regulon]
  • view in new tab

    additional information

  • the mRNA is cleaved by [protein|BAB297D18F94FFA67B8D12A684AB4D1BCDFB4981|RNase III] [PubMed|26883633]
  • Biological materials

    Mutant

  • BKE35650 ([gene|62A3CC548E033A45F94FE4386EE29711A6A14C6B|tagU]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE35650 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCTTTGCACCTCGTCTG, downstream forward: _UP4_TAAAACAAAAAGAAGCTTCG
  • BKK35650 ([gene|62A3CC548E033A45F94FE4386EE29711A6A14C6B|tagU]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK35650 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCTTTGCACCTCGTCTG, downstream forward: _UP4_TAAAACAAAAAGAAGCTTCG
  • References

    Reviews

  • 24024634
  • Original publications

  • 9636707,1357079,19099556,21964069,26883633,29107701,31969390