SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


phosphotransferase, attaches teichoic acid, teichuronic acid, or acidic capsular polysaccharide to cell wall peptidoglycan via phosphodiester linkage to N-acteylmuramic acid
34.43 kDa
protein length
306 aa Sequence Blast
gene length
921 bp Sequence Blast
transfer of anionic cell wall polymers from lipid-linked precursors to peptidoglycan
phosphotransferase, responsible for attachment of anionic polymers to peptidoglycan

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.1|Cell wall synthesis] → [category|SW|Export of anionic polymers and attachment to peptidoglycan]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,663,281 3,664,201

    Phenotypes of a mutant

  • a ''[gene|62A3CC548E033A45F94FE4386EE29711A6A14C6B|tagU]'' mutant has no phenoype, the triple ''[gene|68FE85BAA457199D34C9068F38756972CD2D280D|tagT] [gene|62A3CC548E033A45F94FE4386EE29711A6A14C6B|tagU] [gene|E244A5ABB2FBD4FC3880F0DB700BD935991AE6DD|tagV]'' mutant is unable to grow under normal conditions [Pubmed|21964069]
  • The protein

    Protein family

  • LytR/CpsA/Psr (LCP) family (with [protein|E244A5ABB2FBD4FC3880F0DB700BD935991AE6DD|TagV] and [protein|68FE85BAA457199D34C9068F38756972CD2D280D|TagT], according to UniProt) [Pubmed|19099556]
  • Paralogous protein(s)

  • [protein|68FE85BAA457199D34C9068F38756972CD2D280D|TagT], [protein|E244A5ABB2FBD4FC3880F0DB700BD935991AE6DD|TagV]
  • [SW|Cofactors]

  • Mg2+ [Pubmed|29107701,21964069]
  • Structure

  • [PDB|6UF6] (aa 62-306) [pubmed|31969390]
  • [PDB|3MEJ] ([protein|68FE85BAA457199D34C9068F38756972CD2D280D|TagT], 36% identity, 69% similarity)
  • [SW|Localization]

  • cytoplasmic membrane (with extracytoplasmic catalaytic domain) [Pubmed|21964069]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1357079,9636707], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|19047346], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • [protein|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX]: sigma factor, [Pubmed|1357079,9636707], in [regulon|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX regulon]
  • regulatory mechanism

  • [protein|62A3CC548E033A45F94FE4386EE29711A6A14C6B|TagU]: auto-repression, [Pubmed|1357079], in [regulon|62A3CC548E033A45F94FE4386EE29711A6A14C6B|TagU regulon]
  • view in new tab

    additional information

  • the mRNA is cleaved by [protein|BAB297D18F94FFA67B8D12A684AB4D1BCDFB4981|RNase III] [PubMed|26883633]
  • Biological materials


  • BKE35650 ([gene|62A3CC548E033A45F94FE4386EE29711A6A14C6B|tagU]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCTTTGCACCTCGTCTG, downstream forward: _UP4_TAAAACAAAAAGAAGCTTCG
  • BKK35650 ([gene|62A3CC548E033A45F94FE4386EE29711A6A14C6B|tagU]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCTTTGCACCTCGTCTG, downstream forward: _UP4_TAAAACAAAAAGAAGCTTCG
  • References


  • 24024634
  • Original publications

  • 9636707,1357079,19099556,21964069,26883633,29107701,31969390