SubtiBank SubtiBank
argC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

argC

N-acetyl-g-glutamyl-phosphate reductase
locus
BSU_11190
pI
5.17
mw
37.92 kDa
protein length
346 aa Sequence Blast
gene length
1038 bp Sequence Blast
function
biosynthesis of arginine
product
N-acetyl-g-glutamyl-phosphate reductase
essential
no
ec
1.2.1.38
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.4|Biosynthesis/ acquisition of arginine]
  • Gene

    Coordinates
    1,195,034 → 1,196,071

    The protein

    Catalyzed reaction/ biological activity

  • N-acetyl-L-glutamate 5-semialdehyde + NADP+ + phosphate --> H+ + N-acetyl-L-glutamyl 5-phosphate + NADPH (according to UniProt)
  • Protein family

  • NAGSA dehydrogenase family (single member, according to UniProt)
  • Structure

  • [PDB|1VKN] (from Thermotoga maritima, 43% identity)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|62678D45FA1CB1B6AB801FB9F574DDE10DEE068D|argC]-[gene|0FF858E44B3C557EE2C8B3749A458F152E1C535C|argJ]-[gene|8321DF6EE5B84CC9A4A5DF670E8611F4D61EBC7E|argB]-[gene|7FA5502FE82D55EC176F68B74B24293EC9B7D4D7|argD]-[gene|4202EAE5D0B2A718382092423DD99E35FDE81218|carA]-[gene|7E6386F1949A6F46E4332BAB8F803742EB076AF0|carB]-[gene|11E7D77EF9439F817C10BF5D9671C5AE66AF06DC|argF]
    description
    [Pubmed|7511775]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|7511775], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|AhrC]: repression, [Pubmed|1312212], in [regulon|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|AhrC regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|24843172], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|F4097349A563503468A2A14F062AEAC532C7917A|YlxR]: regulation, [pubmed|30355672], in [regulon|F4097349A563503468A2A14F062AEAC532C7917A|YlxR regulon]
  • regulation

  • repressed by arginine ([protein|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|AhrC]) [Pubmed|1312212]
  • induced in the absence of [protein|F4097349A563503468A2A14F062AEAC532C7917A|YlxR] [pubmed|30355672]
  • view in new tab

    Biological materials

    Mutant

  • BKE11190 (Δ[gene|62678D45FA1CB1B6AB801FB9F574DDE10DEE068D|argC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE11190 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAACAAGTTCACCCTCTT, downstream forward: _UP4_CCATAGAACGGGAGAGAATC
  • BKK11190 (Δ[gene|62678D45FA1CB1B6AB801FB9F574DDE10DEE068D|argC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK11190 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAACAAGTTCACCCTCTT, downstream forward: _UP4_CCATAGAACGGGAGAGAATC
  • References

  • 6096675,2117746,7511775,12107147,24843172,2497296,1312212